Incidental Mutation 'R2208:Nup88'
ID 236785
Institutional Source Beutler Lab
Gene Symbol Nup88
Ensembl Gene ENSMUSG00000040667
Gene Name nucleoporin 88
Synonyms Nup84, Prei2
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70943058-70969973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70965719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 196 (D196G)
Ref Sequence ENSEMBL: ENSMUSP00000104171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018593] [ENSMUST00000035283] [ENSMUST00000108529] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000154430] [ENSMUST00000171254] [ENSMUST00000169965] [ENSMUST00000178822] [ENSMUST00000167509]
AlphaFold Q8CEC0
Predicted Effect probably benign
Transcript: ENSMUST00000018593
SMART Domains Protein: ENSMUSP00000018593
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 8 47 1.7e-21 PFAM
Pfam:RPA_interact_M 59 127 1.1e-14 PFAM
Pfam:RPA_interact_C 136 217 2.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000035283
AA Change: D196G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667
AA Change: D196G

Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108529
SMART Domains Protein: ENSMUSP00000104169
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 48 7.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108530
AA Change: D196G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667
AA Change: D196G

Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108531
AA Change: D196G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667
AA Change: D196G

Pfam:Nup88 11 747 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151608
Predicted Effect probably benign
Transcript: ENSMUST00000178253
Predicted Effect probably benign
Transcript: ENSMUST00000154430
SMART Domains Protein: ENSMUSP00000137113
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 38 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171254
SMART Domains Protein: ENSMUSP00000133243
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 48 1.1e-23 PFAM
Pfam:RPA_interact_M 58 107 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169965
SMART Domains Protein: ENSMUSP00000128903
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 48 1e-23 PFAM
Pfam:RPA_interact_M 58 106 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178822
SMART Domains Protein: ENSMUSP00000136592
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167509
SMART Domains Protein: ENSMUSP00000127315
Gene: ENSMUSG00000018449

Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.1e-16 PFAM
Meta Mutation Damage Score 0.8070 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Nup88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Nup88 APN 11 70954654 splice site probably benign
IGL02219:Nup88 APN 11 70969692 missense probably benign 0.45
IGL02433:Nup88 APN 11 70969888 missense probably benign 0.13
IGL02666:Nup88 APN 11 70943869 intron probably benign
IGL02669:Nup88 APN 11 70956284 missense probably damaging 0.99
IGL02951:Nup88 APN 11 70944872 missense possibly damaging 0.94
unholy UTSW 11 70956192 missense probably damaging 1.00
PIT4515001:Nup88 UTSW 11 70944721 missense probably benign 0.00
R0445:Nup88 UTSW 11 70947729 missense probably benign 0.44
R0737:Nup88 UTSW 11 70969950 start codon destroyed probably null 0.90
R0920:Nup88 UTSW 11 70956320 missense possibly damaging 0.80
R1337:Nup88 UTSW 11 70944890 missense probably damaging 1.00
R3735:Nup88 UTSW 11 70956192 missense probably damaging 1.00
R4577:Nup88 UTSW 11 70969717 missense probably damaging 0.96
R4600:Nup88 UTSW 11 70969696 nonsense probably null
R4663:Nup88 UTSW 11 70965846 splice site probably null
R4812:Nup88 UTSW 11 70965726 missense probably damaging 1.00
R4824:Nup88 UTSW 11 70961624 missense probably benign 0.10
R5333:Nup88 UTSW 11 70945016 intron probably benign
R5338:Nup88 UTSW 11 70944908 missense probably damaging 0.98
R5443:Nup88 UTSW 11 70958430 nonsense probably null
R5605:Nup88 UTSW 11 70944070 intron probably benign
R5869:Nup88 UTSW 11 70969671 missense probably benign
R6287:Nup88 UTSW 11 70965755 missense probably benign 0.39
R6364:Nup88 UTSW 11 70947786 missense probably benign
R6409:Nup88 UTSW 11 70944972 missense probably null 0.71
R6555:Nup88 UTSW 11 70944180 missense possibly damaging 0.62
R7203:Nup88 UTSW 11 70945254 missense probably benign 0.20
R7606:Nup88 UTSW 11 70961615 missense possibly damaging 0.89
R7620:Nup88 UTSW 11 70969779 missense probably benign 0.00
R7681:Nup88 UTSW 11 70969885 missense probably benign 0.05
R8283:Nup88 UTSW 11 70958340 missense probably benign
R8379:Nup88 UTSW 11 70969781 missense possibly damaging 0.72
R8684:Nup88 UTSW 11 70969861 missense probably benign
R8806:Nup88 UTSW 11 70944115 missense probably benign 0.01
R9368:Nup88 UTSW 11 70967930 missense probably damaging 0.99
R9748:Nup88 UTSW 11 70969671 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-02