Incidental Mutation 'R2208:Msi2'
Institutional Source Beutler Lab
Gene Symbol Msi2
Ensembl Gene ENSMUSG00000069769
Gene Namemusashi RNA-binding protein 2
Synonymsmsi2h, Musashi2
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosomal Location88339382-88718513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88590108 bp
Amino Acid Change Serine to Threonine at position 118 (S118T)
Ref Sequence ENSEMBL: ENSMUSP00000103542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092794] [ENSMUST00000107909] [ENSMUST00000144699]
Predicted Effect probably damaging
Transcript: ENSMUST00000092794
AA Change: S118T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090470
Gene: ENSMUSG00000069769
AA Change: S118T

RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
low complexity region 275 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107909
AA Change: S118T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103542
Gene: ENSMUSG00000069769
AA Change: S118T

RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138790
Predicted Effect probably damaging
Transcript: ENSMUST00000144699
AA Change: S96T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119684
Gene: ENSMUSG00000069769
AA Change: S96T

RRM 1 72 8.31e-21 SMART
internal_repeat_1 90 113 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148013
Meta Mutation Damage Score 0.3011 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality, decreased body size, and decreased hematopoietic stem cells. Mice homozygous for a conditional knock-out allele exhibit impaired hematopoietic stem cell physiology upon induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Msi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mikimoto UTSW 11 88366784 critical splice donor site probably null
mixmaster UTSW 11 88716580 missense probably damaging 1.00
miyamoto UTSW 11 88716580 missense probably damaging 1.00
P0027:Msi2 UTSW 11 88394597 missense probably damaging 1.00
R1366:Msi2 UTSW 11 88716580 missense probably damaging 1.00
R2414:Msi2 UTSW 11 88716547 missense probably damaging 1.00
R4151:Msi2 UTSW 11 88718044 missense probably damaging 1.00
R4166:Msi2 UTSW 11 88347088 missense probably benign 0.29
R4494:Msi2 UTSW 11 88717359 missense possibly damaging 0.91
R4647:Msi2 UTSW 11 88718038 missense possibly damaging 0.83
R4952:Msi2 UTSW 11 88366784 critical splice donor site probably null
R4975:Msi2 UTSW 11 88394655 missense probably damaging 1.00
R5441:Msi2 UTSW 11 88479992 splice site probably benign
R5441:Msi2 UTSW 11 88718095 intron probably benign
R5715:Msi2 UTSW 11 88386063 missense probably damaging 1.00
R5768:Msi2 UTSW 11 88717738 missense probably damaging 1.00
R7297:Msi2 UTSW 11 88480038 missense probably damaging 0.97
R7505:Msi2 UTSW 11 88413917 missense possibly damaging 0.89
T0722:Msi2 UTSW 11 88394597 missense probably damaging 1.00
Z1176:Msi2 UTSW 11 88348792 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-02