Incidental Mutation 'R2208:Krt36'
ID 236787
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Name keratin 36
Synonyms Krt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 100102007-100105626 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100102939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 358 (V358M)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
AlphaFold B1AQ75
Predicted Effect probably damaging
Transcript: ENSMUST00000107416
AA Change: V358M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: V358M

low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127883
Meta Mutation Damage Score 0.1821 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1201:Krt36 UTSW 11 100104057 missense probably benign 0.22
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R4303:Krt36 UTSW 11 100103413 missense possibly damaging 0.59
R5140:Krt36 UTSW 11 100103502 missense probably damaging 1.00
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R5944:Krt36 UTSW 11 100105313 missense probably benign
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R6856:Krt36 UTSW 11 100103390 missense probably damaging 1.00
R7153:Krt36 UTSW 11 100105146 nonsense probably null
R7602:Krt36 UTSW 11 100102960 missense probably benign 0.00
R7822:Krt36 UTSW 11 100104140 missense possibly damaging 0.86
R7894:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R8234:Krt36 UTSW 11 100104201 missense probably damaging 1.00
R8480:Krt36 UTSW 11 100102809 missense possibly damaging 0.95
R8904:Krt36 UTSW 11 100105347 missense probably benign 0.00
R8969:Krt36 UTSW 11 100102303 missense probably damaging 0.98
R8987:Krt36 UTSW 11 100103546 missense possibly damaging 0.74
R9297:Krt36 UTSW 11 100103445 missense probably damaging 1.00
R9314:Krt36 UTSW 11 100103401 nonsense probably null
R9387:Krt36 UTSW 11 100104080 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-02