Mutagenetix > Incidental Mutation

Incidental Mutation 'R2208:Krt36'

236787

Institutional Source

Beutler Lab

Gene Symbol

Krt36

Ensembl Gene

ENSMUSG00000020916

Gene Name

keratin 36

Synonyms

Krt1-22, keratin 5, HRa-1, Krt1-5

MMRRC Submission

040210-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R2208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100102007-100105626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 100102939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 358 (V358M)

Ref Sequence

ENSEMBL: ENSMUSP00000103039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107416]

AlphaFold

B1AQ75

Predicted Effect

probably damaging
Transcript: ENSMUST00000107416
AA Change: V358M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: V358M

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Filament	92	403	4.05e-163	SMART
low complexity region	425	443	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127883

Meta Mutation Damage Score

0.1821

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,194,403	N883K	probably benign	Het
Ahnak	T	C	19: 9,017,732	V5460A	probably benign	Het
Bco2	A	G	9: 50,533,455	V517A	probably damaging	Het
Brca2	T	A	5: 150,532,344	D183E	probably damaging	Het
Ccdc142	T	C	6: 83,107,960		probably null	Het
Ccdc39	A	G	3: 33,841,178	L34P	probably damaging	Het
Cdc42bpb	T	A	12: 111,336,029	H198L	probably damaging	Het
Cdc73	T	A	1: 143,609,382	E516V	probably damaging	Het
Cep170b	T	A	12: 112,738,985	L1059Q	probably benign	Het
Chrm1	T	C	19: 8,678,099	L56P	probably damaging	Het
Clec4d	T	A	6: 123,265,355	V22D	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp2d12	T	C	15: 82,556,936	L141P	probably damaging	Het
Cyp4x1	G	T	4: 115,126,594	Q85K	probably benign	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Enpp7	T	C	11: 118,988,762		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fitm2	T	A	2: 163,472,684		probably benign	Het
Gm14139	T	A	2: 150,193,145	V462E	probably benign	Het
Gng10	T	A	4: 59,035,314	I26N	possibly damaging	Het
Gpr33	C	T	12: 52,023,453	V268I	probably benign	Het
Hmcn2	G	A	2: 31,380,297	C1182Y	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Lmod3	T	C	6: 97,247,877	I328V	probably benign	Het
Lrp8	T	C	4: 107,855,790	V580A	probably damaging	Het
Masp2	T	C	4: 148,614,415	I651T	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Msi2	A	T	11: 88,590,108	S118T	probably damaging	Het
Muc19	T	C	15: 91,871,549		noncoding transcript	Het
Nabp1	G	A	1: 51,477,614	R32*	probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nup88	T	C	11: 70,965,719	D196G	probably damaging	Het
Olfr747	T	C	14: 50,681,563	I24V	probably benign	Het
Pax1	T	A	2: 147,365,802	I198N	probably damaging	Het
Pde3a	A	G	6: 141,250,347	E253G	probably damaging	Het
Phldb1	C	T	9: 44,696,131	R1192Q	probably damaging	Het
Pianp	C	A	6: 124,999,639	P137Q	probably damaging	Het
Prdm15	A	C	16: 97,799,264		probably null	Het
Ptprf	A	T	4: 118,269,172		probably benign	Het
Rfx7	A	G	9: 72,617,964	D812G	probably benign	Het
Rgs22	T	C	15: 36,050,232	T691A	probably benign	Het
Rundc3a	A	T	11: 102,402,088	S436C	probably damaging	Het
Sntb1	T	C	15: 55,906,318	T92A	possibly damaging	Het
Tarsl2	T	C	7: 65,682,848	S566P	probably damaging	Het
Tbc1d32	A	T	10: 56,150,792		probably null	Het
Tep1	T	C	14: 50,866,864	Q191R	probably benign	Het
Tmc2	C	A	2: 130,214,563		probably null	Het
Tns1	A	C	1: 74,079,240	I77S	probably damaging	Het
Trpd52l3	T	C	19: 30,004,246	W134R	probably damaging	Het
Vmn2r15	A	C	5: 109,297,443	N38K	possibly damaging	Het
Wdr90	A	T	17: 25,860,388	D257E	probably damaging	Het
Zbtb9	T	C	17: 26,974,124	C168R	possibly damaging	Het

Other mutations in Krt36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Krt36	APN	11	100102948	missense	probably damaging	0.98
IGL01737:Krt36	APN	11	100104120	missense	possibly damaging	0.62
IGL02388:Krt36	APN	11	100105164	nonsense	probably null
IGL02985:Krt36	APN	11	100103179	missense	probably benign	0.32
R0393:Krt36	UTSW	11	100104114	missense	possibly damaging	0.91
R0617:Krt36	UTSW	11	100102275	missense	probably damaging	1.00
R0930:Krt36	UTSW	11	100103399	missense	probably damaging	1.00
R1166:Krt36	UTSW	11	100102828	missense	probably benign	0.00
R1201:Krt36	UTSW	11	100104057	missense	probably benign	0.22
R1587:Krt36	UTSW	11	100102302	missense	probably damaging	1.00
R1750:Krt36	UTSW	11	100104058	missense	probably benign	0.00
R1826:Krt36	UTSW	11	100103030	splice site	probably benign
R1846:Krt36	UTSW	11	100105548	missense	probably damaging	1.00
R4303:Krt36	UTSW	11	100103413	missense	possibly damaging	0.59
R5140:Krt36	UTSW	11	100103502	missense	probably damaging	1.00
R5719:Krt36	UTSW	11	100104161	missense	possibly damaging	0.95
R5944:Krt36	UTSW	11	100105313	missense	probably benign
R6188:Krt36	UTSW	11	100102420	missense	probably benign	0.00
R6271:Krt36	UTSW	11	100104472	nonsense	probably null
R6809:Krt36	UTSW	11	100105509	missense	probably benign	0.00
R6856:Krt36	UTSW	11	100103390	missense	probably damaging	1.00
R7153:Krt36	UTSW	11	100105146	nonsense	probably null
R7602:Krt36	UTSW	11	100102960	missense	probably benign	0.00
R7822:Krt36	UTSW	11	100104140	missense	possibly damaging	0.86
R7894:Krt36	UTSW	11	100105235	missense	probably damaging	1.00
R8234:Krt36	UTSW	11	100104201	missense	probably damaging	1.00
R8480:Krt36	UTSW	11	100102809	missense	possibly damaging	0.95
R8904:Krt36	UTSW	11	100105347	missense	probably benign	0.00
R8969:Krt36	UTSW	11	100102303	missense	probably damaging	0.98
R8987:Krt36	UTSW	11	100103546	missense	possibly damaging	0.74
R9297:Krt36	UTSW	11	100103445	missense	probably damaging	1.00
R9314:Krt36	UTSW	11	100103401	nonsense	probably null
R9387:Krt36	UTSW	11	100104080	missense	probably damaging	1.00
R9585:Krt36	UTSW	11	100104066	missense	probably damaging	1.00
Z1088:Krt36	UTSW	11	100104189	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCTTCATCTTTGTAAGAGCCGC -3'
(R):5'- TGTTATCACAGGGCCAAACCAC -3'

Sequencing Primer
(F):5'- TCTGAAAGTGTGTCAAGCCC -3'
(R):5'- ACAACTGTGTGCGGATGC -3'

Posted On

2014-10-02