Incidental Mutation 'R2208:Enpp7'
Institutional Source Beutler Lab
Gene Symbol Enpp7
Ensembl Gene ENSMUSG00000046697
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 7
SynonymsLOC238011, Alk-SMase
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosomal Location118988188-118992841 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118988762 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092373] [ENSMUST00000106273]
Predicted Effect probably benign
Transcript: ENSMUST00000092373
SMART Domains Protein: ENSMUSP00000090027
Gene: ENSMUSG00000046697

signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 2.5e-76 PFAM
Pfam:Metalloenzyme 43 272 8.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106273
SMART Domains Protein: ENSMUSP00000101880
Gene: ENSMUSG00000046697

signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 3e-77 PFAM
Pfam:Metalloenzyme 41 257 5.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intestinal alkaline sphingomyelin phosphodiesterase that converts sphingomyelin to ceramide and phosphocholine. The encoded protein is anchored in the cell membrane, and it may function to protect the intestinal mucosa from inflammation and tumorigenesis. This protein is glycosylated and also exhibits lysophosphatidylcholine hydrolase activity. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit intestinal epithelium hypertrophy, decreased crypt and villi width, and impaired sphingomyelin digestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Enpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Enpp7 APN 11 118990545 missense probably damaging 1.00
IGL02488:Enpp7 APN 11 118988814 missense probably damaging 1.00
IGL02672:Enpp7 APN 11 118992340 critical splice donor site probably null
R0465:Enpp7 UTSW 11 118988781 missense probably damaging 1.00
R1718:Enpp7 UTSW 11 118990983 missense probably damaging 1.00
R2970:Enpp7 UTSW 11 118990646 missense probably damaging 1.00
R3713:Enpp7 UTSW 11 118990518 missense probably damaging 1.00
R3967:Enpp7 UTSW 11 118991001 missense probably damaging 0.99
R5222:Enpp7 UTSW 11 118990962 missense probably benign 0.03
R5454:Enpp7 UTSW 11 118988808 missense probably benign 0.03
R5577:Enpp7 UTSW 11 118992127 missense probably benign 0.01
R7361:Enpp7 UTSW 11 118992159 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-02