Incidental Mutation 'R2208:Cep170b'
ID236792
Institutional Source Beutler Lab
Gene Symbol Cep170b
Ensembl Gene ENSMUSG00000072825
Gene Namecentrosomal protein 170B
Synonyms
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.563) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112720455-112746592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112738985 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1059 (L1059Q)
Ref Sequence ENSEMBL: ENSMUSP00000152451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092279] [ENSMUST00000101018] [ENSMUST00000179041] [ENSMUST00000220627] [ENSMUST00000222711]
Predicted Effect probably benign
Transcript: ENSMUST00000092279
SMART Domains Protein: ENSMUSP00000089930
Gene: ENSMUSG00000072825

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
Pfam:CEP170_C 204 598 8.9e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101018
AA Change: L1059Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000098580
Gene: ENSMUSG00000072825
AA Change: L1059Q

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 831 1514 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179041
AA Change: L1059Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137331
Gene: ENSMUSG00000072825
AA Change: L1059Q

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 832 1510 4.3e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220627
AA Change: L1059Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222612
Predicted Effect probably benign
Transcript: ENSMUST00000222711
AA Change: L1059Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223104
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Cep170b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cep170b APN 12 112735194 missense probably damaging 1.00
IGL01313:Cep170b APN 12 112735652 missense probably damaging 1.00
IGL01317:Cep170b APN 12 112737644 missense probably damaging 1.00
IGL01660:Cep170b APN 12 112744160 missense probably damaging 1.00
IGL02032:Cep170b APN 12 112737333 critical splice donor site probably null
IGL02505:Cep170b APN 12 112743070 missense probably damaging 1.00
IGL02966:Cep170b APN 12 112736444 missense possibly damaging 0.75
IGL03111:Cep170b APN 12 112735179 missense probably damaging 1.00
IGL03367:Cep170b APN 12 112737238 missense probably benign 0.00
R0348:Cep170b UTSW 12 112736806 missense probably damaging 1.00
R0562:Cep170b UTSW 12 112739189 missense probably benign 0.00
R0909:Cep170b UTSW 12 112732039 missense probably null 0.06
R1217:Cep170b UTSW 12 112740905 missense probably damaging 0.99
R1300:Cep170b UTSW 12 112737257 missense probably benign 0.02
R1647:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1648:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1652:Cep170b UTSW 12 112733513 missense probably damaging 0.99
R1737:Cep170b UTSW 12 112736627 missense possibly damaging 0.71
R1936:Cep170b UTSW 12 112735738 missense probably damaging 1.00
R1962:Cep170b UTSW 12 112738061 missense probably damaging 1.00
R2094:Cep170b UTSW 12 112735730 missense possibly damaging 0.90
R3418:Cep170b UTSW 12 112738468 nonsense probably null
R3735:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R3736:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R4299:Cep170b UTSW 12 112739305 missense probably damaging 1.00
R4577:Cep170b UTSW 12 112744718 missense probably damaging 1.00
R5199:Cep170b UTSW 12 112744147 missense probably damaging 1.00
R5512:Cep170b UTSW 12 112733485 missense possibly damaging 0.86
R5575:Cep170b UTSW 12 112735632 missense probably damaging 1.00
R5643:Cep170b UTSW 12 112740841 missense probably benign 0.35
R6074:Cep170b UTSW 12 112744155 missense probably damaging 1.00
R6265:Cep170b UTSW 12 112744559 missense probably damaging 1.00
R6371:Cep170b UTSW 12 112740945 missense probably damaging 1.00
R6376:Cep170b UTSW 12 112732068 missense probably damaging 0.99
R7055:Cep170b UTSW 12 112735715 missense probably damaging 1.00
R7137:Cep170b UTSW 12 112735167 missense probably benign
R7226:Cep170b UTSW 12 112737925 missense possibly damaging 0.80
R7615:Cep170b UTSW 12 112744665 missense probably damaging 1.00
R7831:Cep170b UTSW 12 112744800 missense probably benign 0.08
R7914:Cep170b UTSW 12 112744800 missense probably benign 0.08
Z1176:Cep170b UTSW 12 112741012 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGAAGGAGAGCCCATTGTCTC -3'
(R):5'- ATCCACAGCCTCAGTGTCTG -3'

Sequencing Primer
(F):5'- ACAGTACCAGACCCAGGGG -3'
(R):5'- TGTCTGAGGCATCCCCTAGAC -3'
Posted On2014-10-02