Incidental Mutation 'R2208:Olfr747'
ID 236793
Institutional Source Beutler Lab
Gene Symbol Olfr747
Ensembl Gene ENSMUSG00000057179
Gene Name olfactory receptor 747
Synonyms GA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2208 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50680657-50693206 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50681563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 24 (I24V)
Ref Sequence ENSEMBL: ENSMUSP00000149081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078075] [ENSMUST00000205373] [ENSMUST00000205897] [ENSMUST00000213238]
AlphaFold E9PXH6
Predicted Effect probably benign
Transcript: ENSMUST00000078075
AA Change: I24V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077220
Gene: ENSMUSG00000057179
AA Change: I24V

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-53 PFAM
Pfam:7tm_1 40 289 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205373
AA Change: I24V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000205897
Predicted Effect probably benign
Transcript: ENSMUST00000213238
AA Change: I24V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Olfr747
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Olfr747 APN 14 50681200 missense probably benign 0.04
R0349:Olfr747 UTSW 14 50681254 missense probably benign 0.00
R0613:Olfr747 UTSW 14 50681404 missense probably benign 0.06
R1023:Olfr747 UTSW 14 50681016 missense probably damaging 1.00
R1126:Olfr747 UTSW 14 50681263 missense possibly damaging 0.94
R1298:Olfr747 UTSW 14 50680880 nonsense probably null
R1344:Olfr747 UTSW 14 50680858 missense probably benign
R1775:Olfr747 UTSW 14 50681166 missense possibly damaging 0.66
R1928:Olfr747 UTSW 14 50681415 missense probably benign 0.00
R4181:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4183:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4184:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R5104:Olfr747 UTSW 14 50680702 nonsense probably null
R6144:Olfr747 UTSW 14 50680935 missense probably benign 0.01
R6768:Olfr747 UTSW 14 50681592 missense probably damaging 1.00
R7026:Olfr747 UTSW 14 50681259 missense probably damaging 0.98
R7454:Olfr747 UTSW 14 50680824 missense possibly damaging 0.94
R7777:Olfr747 UTSW 14 50680804 missense probably damaging 1.00
R7851:Olfr747 UTSW 14 50681458 missense probably damaging 1.00
R8427:Olfr747 UTSW 14 50681149 missense probably damaging 0.99
X0067:Olfr747 UTSW 14 50681529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCACCCTGAAAATGAGATGGC -3'
(R):5'- GTCATTTGTGTCTAGACAGTCAGTG -3'

Sequencing Primer
(F):5'- CCTGAAAATGAGATGGCCTTGGTC -3'
(R):5'- GTCTAGACAGTCAGTGTTATTCATC -3'
Posted On 2014-10-02