Mutagenetix > Incidental Mutation

Incidental Mutation 'R2208:Tep1'

236794

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

040210-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50866864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 191 (Q191R)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

AlphaFold

P97499

Predicted Effect

probably benign
Transcript: ENSMUST00000006444
AA Change: Q191R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: Q191R

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181697

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228254

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,194,403	N883K	probably benign	Het
Ahnak	T	C	19: 9,017,732	V5460A	probably benign	Het
Bco2	A	G	9: 50,533,455	V517A	probably damaging	Het
Brca2	T	A	5: 150,532,344	D183E	probably damaging	Het
Ccdc142	T	C	6: 83,107,960		probably null	Het
Ccdc39	A	G	3: 33,841,178	L34P	probably damaging	Het
Cdc42bpb	T	A	12: 111,336,029	H198L	probably damaging	Het
Cdc73	T	A	1: 143,609,382	E516V	probably damaging	Het
Cep170b	T	A	12: 112,738,985	L1059Q	probably benign	Het
Chrm1	T	C	19: 8,678,099	L56P	probably damaging	Het
Clec4d	T	A	6: 123,265,355	V22D	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp2d12	T	C	15: 82,556,936	L141P	probably damaging	Het
Cyp4x1	G	T	4: 115,126,594	Q85K	probably benign	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Enpp7	T	C	11: 118,988,762		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fitm2	T	A	2: 163,472,684		probably benign	Het
Gm14139	T	A	2: 150,193,145	V462E	probably benign	Het
Gng10	T	A	4: 59,035,314	I26N	possibly damaging	Het
Gpr33	C	T	12: 52,023,453	V268I	probably benign	Het
Hmcn2	G	A	2: 31,380,297	C1182Y	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Krt36	C	T	11: 100,102,939	V358M	probably damaging	Het
Lmod3	T	C	6: 97,247,877	I328V	probably benign	Het
Lrp8	T	C	4: 107,855,790	V580A	probably damaging	Het
Masp2	T	C	4: 148,614,415	I651T	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Msi2	A	T	11: 88,590,108	S118T	probably damaging	Het
Muc19	T	C	15: 91,871,549		noncoding transcript	Het
Nabp1	G	A	1: 51,477,614	R32*	probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nup88	T	C	11: 70,965,719	D196G	probably damaging	Het
Olfr747	T	C	14: 50,681,563	I24V	probably benign	Het
Pax1	T	A	2: 147,365,802	I198N	probably damaging	Het
Pde3a	A	G	6: 141,250,347	E253G	probably damaging	Het
Phldb1	C	T	9: 44,696,131	R1192Q	probably damaging	Het
Pianp	C	A	6: 124,999,639	P137Q	probably damaging	Het
Prdm15	A	C	16: 97,799,264		probably null	Het
Ptprf	A	T	4: 118,269,172		probably benign	Het
Rfx7	A	G	9: 72,617,964	D812G	probably benign	Het
Rgs22	T	C	15: 36,050,232	T691A	probably benign	Het
Rundc3a	A	T	11: 102,402,088	S436C	probably damaging	Het
Sntb1	T	C	15: 55,906,318	T92A	possibly damaging	Het
Tarsl2	T	C	7: 65,682,848	S566P	probably damaging	Het
Tbc1d32	A	T	10: 56,150,792		probably null	Het
Tmc2	C	A	2: 130,214,563		probably null	Het
Tns1	A	C	1: 74,079,240	I77S	probably damaging	Het
Trpd52l3	T	C	19: 30,004,246	W134R	probably damaging	Het
Vmn2r15	A	C	5: 109,297,443	N38K	possibly damaging	Het
Wdr90	A	T	17: 25,860,388	D257E	probably damaging	Het
Zbtb9	T	C	17: 26,974,124	C168R	possibly damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
R0240_Tep1_347	UTSW	14	50863029	splice site	probably benign
R0972_Tep1_893	UTSW	14	50824296	unclassified	probably benign
R1686_Tep1_375	UTSW	14	50836788	missense	probably benign	0.12
R7232_Tep1_671	UTSW	14	50844332	missense	unknown
R8009_Tep1_822	UTSW	14	50824230	missense	possibly damaging	0.93
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
R8695:Tep1	UTSW	14	50845437	missense	possibly damaging	0.85
R8726:Tep1	UTSW	14	50847623	missense	probably damaging	0.98
R8812:Tep1	UTSW	14	50837132	missense	probably damaging	0.98
R9152:Tep1	UTSW	14	50866705	missense	probably benign	0.14
R9269:Tep1	UTSW	14	50844309	missense	probably damaging	0.98
R9299:Tep1	UTSW	14	50844531	splice site	probably benign
R9365:Tep1	UTSW	14	50827140	missense	probably damaging	1.00
R9398:Tep1	UTSW	14	50828972	missense	possibly damaging	0.85
R9408:Tep1	UTSW	14	50837180	missense	possibly damaging	0.85
R9445:Tep1	UTSW	14	50845510	missense	possibly damaging	0.95
R9487:Tep1	UTSW	14	50829230	missense	possibly damaging	0.93
R9555:Tep1	UTSW	14	50868431	missense	possibly damaging	0.52
R9597:Tep1	UTSW	14	50863008	missense	probably damaging	0.99
R9715:Tep1	UTSW	14	50844302	missense
R9732:Tep1	UTSW	14	50850705	missense	probably benign	0.33
R9777:Tep1	UTSW	14	50838986	nonsense	probably null
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCTCCTGAAGGACCTGGTCAG -3'
(R):5'- CAGTCATGAAATGGCAGCGG -3'

Sequencing Primer
(F):5'- AAGGACCTGGTCAGTGGTTTCAG -3'
(R):5'- CGGGGAAGACCACAGAGCATC -3'

Posted On

2014-10-02