Incidental Mutation 'R2208:Cplane1'
ID 236795
Institutional Source Beutler Lab
Gene Symbol Cplane1
Ensembl Gene ENSMUSG00000039801
Gene Name ciliogenesis and planar polarity effector 1
Synonyms Hug, 2410089E03Rik, b2b012Clo, Jbts17
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8198590-8300642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8223887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 883 (N883K)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: N883K

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: N883K

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130748
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Cplane1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Cplane1 APN 15 8,293,931 (GRCm39) splice site probably benign
IGL00766:Cplane1 APN 15 8,281,648 (GRCm39) missense unknown
IGL01483:Cplane1 APN 15 8,216,591 (GRCm39) missense probably damaging 0.98
IGL01520:Cplane1 APN 15 8,251,395 (GRCm39) missense probably damaging 0.96
IGL01578:Cplane1 APN 15 8,300,194 (GRCm39) missense unknown
IGL01701:Cplane1 APN 15 8,232,741 (GRCm39) splice site probably benign
IGL01892:Cplane1 APN 15 8,271,749 (GRCm39) splice site probably benign
IGL01895:Cplane1 APN 15 8,258,591 (GRCm39) missense possibly damaging 0.63
IGL01922:Cplane1 APN 15 8,300,305 (GRCm39) missense unknown
IGL01978:Cplane1 APN 15 8,248,866 (GRCm39) missense probably damaging 0.98
IGL02031:Cplane1 APN 15 8,209,253 (GRCm39) missense probably damaging 0.99
IGL02318:Cplane1 APN 15 8,204,509 (GRCm39) missense probably damaging 0.98
IGL02321:Cplane1 APN 15 8,246,056 (GRCm39) missense probably benign 0.04
IGL02363:Cplane1 APN 15 8,247,921 (GRCm39) missense possibly damaging 0.68
IGL02404:Cplane1 APN 15 8,216,768 (GRCm39) missense possibly damaging 0.48
IGL02535:Cplane1 APN 15 8,204,322 (GRCm39) missense probably damaging 1.00
IGL02732:Cplane1 APN 15 8,209,375 (GRCm39) missense probably benign 0.03
IGL02895:Cplane1 APN 15 8,261,591 (GRCm39) splice site probably benign
IGL02903:Cplane1 APN 15 8,299,262 (GRCm39) missense unknown
IGL02903:Cplane1 APN 15 8,299,263 (GRCm39) missense unknown
IGL02979:Cplane1 APN 15 8,248,038 (GRCm39) missense possibly damaging 0.82
IGL03077:Cplane1 APN 15 8,242,279 (GRCm39) splice site probably benign
IGL03196:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
IGL03344:Cplane1 APN 15 8,216,942 (GRCm39) missense possibly damaging 0.63
IGL03368:Cplane1 APN 15 8,251,857 (GRCm39) missense probably benign 0.06
IGL03403:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
agnes UTSW 15 8,276,422 (GRCm39) nonsense probably null
dei UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0101:Cplane1 UTSW 15 8,250,444 (GRCm39) missense probably benign 0.00
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0165:Cplane1 UTSW 15 8,245,866 (GRCm39) missense probably damaging 1.00
R0306:Cplane1 UTSW 15 8,209,373 (GRCm39) missense probably damaging 1.00
R0433:Cplane1 UTSW 15 8,246,046 (GRCm39) missense probably benign 0.00
R0491:Cplane1 UTSW 15 8,211,727 (GRCm39) missense probably damaging 1.00
R0523:Cplane1 UTSW 15 8,223,870 (GRCm39) missense probably damaging 1.00
R0571:Cplane1 UTSW 15 8,289,277 (GRCm39) missense unknown
R0679:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R0704:Cplane1 UTSW 15 8,239,567 (GRCm39) missense possibly damaging 0.93
R0707:Cplane1 UTSW 15 8,287,805 (GRCm39) missense unknown
R0715:Cplane1 UTSW 15 8,252,576 (GRCm39) missense probably benign 0.14
R0762:Cplane1 UTSW 15 8,247,900 (GRCm39) unclassified probably benign
R0830:Cplane1 UTSW 15 8,276,669 (GRCm39) missense unknown
R0924:Cplane1 UTSW 15 8,280,554 (GRCm39) splice site probably benign
R1071:Cplane1 UTSW 15 8,247,910 (GRCm39) missense probably benign 0.20
R1184:Cplane1 UTSW 15 8,245,971 (GRCm39) missense probably benign
R1224:Cplane1 UTSW 15 8,207,869 (GRCm39) missense probably benign 0.06
R1416:Cplane1 UTSW 15 8,276,422 (GRCm39) nonsense probably null
R1428:Cplane1 UTSW 15 8,248,853 (GRCm39) missense possibly damaging 0.83
R1487:Cplane1 UTSW 15 8,215,715 (GRCm39) missense probably damaging 1.00
R1641:Cplane1 UTSW 15 8,258,443 (GRCm39) missense probably benign 0.41
R1652:Cplane1 UTSW 15 8,230,630 (GRCm39) missense probably damaging 1.00
R1688:Cplane1 UTSW 15 8,258,093 (GRCm39) missense probably benign 0.00
R1715:Cplane1 UTSW 15 8,256,384 (GRCm39) splice site probably null
R1820:Cplane1 UTSW 15 8,299,129 (GRCm39) missense unknown
R1863:Cplane1 UTSW 15 8,258,077 (GRCm39) missense probably benign 0.00
R1940:Cplane1 UTSW 15 8,263,336 (GRCm39) missense probably damaging 0.98
R1967:Cplane1 UTSW 15 8,232,904 (GRCm39) missense probably benign 0.09
R2064:Cplane1 UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R2076:Cplane1 UTSW 15 8,248,741 (GRCm39) missense possibly damaging 0.93
R2163:Cplane1 UTSW 15 8,232,735 (GRCm39) splice site probably null
R2504:Cplane1 UTSW 15 8,248,700 (GRCm39) missense probably damaging 0.99
R2568:Cplane1 UTSW 15 8,230,753 (GRCm39) missense possibly damaging 0.70
R2845:Cplane1 UTSW 15 8,245,864 (GRCm39) missense probably damaging 1.00
R2913:Cplane1 UTSW 15 8,300,169 (GRCm39) missense unknown
R3056:Cplane1 UTSW 15 8,280,491 (GRCm39) missense unknown
R3706:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3707:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3870:Cplane1 UTSW 15 8,247,948 (GRCm39) missense probably damaging 0.98
R3877:Cplane1 UTSW 15 8,251,427 (GRCm39) missense probably benign
R3886:Cplane1 UTSW 15 8,201,289 (GRCm39) missense probably damaging 0.98
R4057:Cplane1 UTSW 15 8,248,509 (GRCm39) missense probably benign 0.08
R4090:Cplane1 UTSW 15 8,241,842 (GRCm39) splice site probably null
R4362:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4363:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4445:Cplane1 UTSW 15 8,281,672 (GRCm39) missense unknown
R4581:Cplane1 UTSW 15 8,201,282 (GRCm39) missense possibly damaging 0.85
R4587:Cplane1 UTSW 15 8,230,636 (GRCm39) missense possibly damaging 0.50
R4659:Cplane1 UTSW 15 8,245,760 (GRCm39) intron probably benign
R4663:Cplane1 UTSW 15 8,247,939 (GRCm39) missense probably benign 0.31
R4779:Cplane1 UTSW 15 8,248,322 (GRCm39) missense probably benign 0.04
R4812:Cplane1 UTSW 15 8,230,607 (GRCm39) splice site probably null
R4850:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R4896:Cplane1 UTSW 15 8,251,421 (GRCm39) missense probably benign 0.00
R5273:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R5273:Cplane1 UTSW 15 8,273,825 (GRCm39) missense probably damaging 0.98
R5303:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5307:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5308:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5373:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5374:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5386:Cplane1 UTSW 15 8,223,897 (GRCm39) missense probably damaging 1.00
R5534:Cplane1 UTSW 15 8,258,319 (GRCm39) missense probably benign 0.06
R5720:Cplane1 UTSW 15 8,233,171 (GRCm39) missense probably benign 0.35
R5891:Cplane1 UTSW 15 8,218,073 (GRCm39) missense probably benign 0.00
R5932:Cplane1 UTSW 15 8,274,079 (GRCm39) splice site probably null
R6053:Cplane1 UTSW 15 8,217,945 (GRCm39) missense probably benign 0.35
R6166:Cplane1 UTSW 15 8,216,044 (GRCm39) missense probably benign 0.00
R6245:Cplane1 UTSW 15 8,207,902 (GRCm39) missense probably benign 0.01
R6246:Cplane1 UTSW 15 8,239,498 (GRCm39) missense probably damaging 1.00
R6541:Cplane1 UTSW 15 8,248,779 (GRCm39) missense possibly damaging 0.48
R6622:Cplane1 UTSW 15 8,273,706 (GRCm39) missense probably damaging 0.98
R6707:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R6729:Cplane1 UTSW 15 8,218,085 (GRCm39) splice site probably null
R6805:Cplane1 UTSW 15 8,273,790 (GRCm39) missense probably benign 0.07
R6806:Cplane1 UTSW 15 8,216,342 (GRCm39) missense possibly damaging 0.55
R6813:Cplane1 UTSW 15 8,258,766 (GRCm39) missense probably benign
R6830:Cplane1 UTSW 15 8,205,668 (GRCm39) missense probably benign 0.04
R6845:Cplane1 UTSW 15 8,251,388 (GRCm39) missense possibly damaging 0.84
R6894:Cplane1 UTSW 15 8,216,852 (GRCm39) missense probably damaging 0.99
R6970:Cplane1 UTSW 15 8,217,032 (GRCm39) missense probably benign 0.01
R6991:Cplane1 UTSW 15 8,281,690 (GRCm39) missense unknown
R7003:Cplane1 UTSW 15 8,258,246 (GRCm39) missense probably damaging 0.99
R7088:Cplane1 UTSW 15 8,248,431 (GRCm39) missense probably benign 0.16
R7104:Cplane1 UTSW 15 8,223,928 (GRCm39) missense possibly damaging 0.83
R7311:Cplane1 UTSW 15 8,210,399 (GRCm39) missense probably damaging 1.00
R7374:Cplane1 UTSW 15 8,276,731 (GRCm39) missense unknown
R7446:Cplane1 UTSW 15 8,261,564 (GRCm39) missense probably damaging 0.98
R7539:Cplane1 UTSW 15 8,230,728 (GRCm39) missense probably benign 0.19
R7543:Cplane1 UTSW 15 8,254,876 (GRCm39) missense unknown
R7558:Cplane1 UTSW 15 8,254,851 (GRCm39) missense unknown
R7629:Cplane1 UTSW 15 8,256,551 (GRCm39) nonsense probably null
R7635:Cplane1 UTSW 15 8,256,404 (GRCm39) missense probably benign 0.01
R7644:Cplane1 UTSW 15 8,252,611 (GRCm39) missense probably benign 0.00
R7705:Cplane1 UTSW 15 8,211,736 (GRCm39) missense probably damaging 1.00
R7752:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7754:Cplane1 UTSW 15 8,273,310 (GRCm39) missense possibly damaging 0.53
R7757:Cplane1 UTSW 15 8,281,711 (GRCm39) missense unknown
R7836:Cplane1 UTSW 15 8,233,241 (GRCm39) missense probably damaging 0.97
R7875:Cplane1 UTSW 15 8,239,446 (GRCm39) missense probably benign 0.18
R7901:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7983:Cplane1 UTSW 15 8,251,299 (GRCm39) missense probably benign 0.01
R8030:Cplane1 UTSW 15 8,259,787 (GRCm39) missense probably damaging 1.00
R8088:Cplane1 UTSW 15 8,215,802 (GRCm39) missense probably benign 0.00
R8231:Cplane1 UTSW 15 8,248,511 (GRCm39) missense probably benign 0.16
R8443:Cplane1 UTSW 15 8,230,635 (GRCm39) missense probably benign 0.03
R8480:Cplane1 UTSW 15 8,216,942 (GRCm39) missense possibly damaging 0.63
R8693:Cplane1 UTSW 15 8,258,492 (GRCm39) missense probably benign 0.15
R8785:Cplane1 UTSW 15 8,204,244 (GRCm39) missense probably benign 0.39
R8791:Cplane1 UTSW 15 8,216,744 (GRCm39) missense probably damaging 1.00
R8822:Cplane1 UTSW 15 8,201,262 (GRCm39) missense probably damaging 1.00
R8831:Cplane1 UTSW 15 8,211,620 (GRCm39) missense probably benign 0.09
R8932:Cplane1 UTSW 15 8,223,859 (GRCm39) missense probably damaging 1.00
R8968:Cplane1 UTSW 15 8,230,765 (GRCm39) missense possibly damaging 0.84
R8973:Cplane1 UTSW 15 8,233,277 (GRCm39) missense probably damaging 1.00
R9036:Cplane1 UTSW 15 8,252,622 (GRCm39) missense possibly damaging 0.63
R9134:Cplane1 UTSW 15 8,228,716 (GRCm39) missense probably damaging 0.99
R9197:Cplane1 UTSW 15 8,280,536 (GRCm39) missense unknown
R9259:Cplane1 UTSW 15 8,232,787 (GRCm39) missense possibly damaging 0.82
R9269:Cplane1 UTSW 15 8,248,500 (GRCm39) missense probably damaging 0.97
R9294:Cplane1 UTSW 15 8,232,811 (GRCm39) missense probably benign 0.00
R9328:Cplane1 UTSW 15 8,215,692 (GRCm39) missense probably damaging 1.00
R9563:Cplane1 UTSW 15 8,216,563 (GRCm39) missense probably benign 0.20
R9680:Cplane1 UTSW 15 8,231,785 (GRCm39) missense possibly damaging 0.68
R9721:Cplane1 UTSW 15 8,254,893 (GRCm39) missense unknown
R9779:Cplane1 UTSW 15 8,230,786 (GRCm39) missense possibly damaging 0.93
R9780:Cplane1 UTSW 15 8,258,123 (GRCm39) missense probably benign 0.00
U24488:Cplane1 UTSW 15 8,211,694 (GRCm39) missense probably damaging 1.00
X0023:Cplane1 UTSW 15 8,276,515 (GRCm39) missense unknown
Z1177:Cplane1 UTSW 15 8,239,473 (GRCm39) missense probably damaging 0.98
Z1177:Cplane1 UTSW 15 8,204,456 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACCCGCATGTCATAATGG -3'
(R):5'- ACTTAGCTACTGTAAAGGCAAGG -3'

Sequencing Primer
(F):5'- CCCGCATGTCATAATGGTATAAC -3'
(R):5'- CTATTAAGTCAGTGGGATGGCAC -3'
Posted On 2014-10-02