Incidental Mutation 'R2208:Rgs22'
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
MMRRC Submission 040210-MU
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36050232 bp
Amino Acid Change Threonine to Alanine at position 691 (T691A)
Ref Sequence ENSEMBL: ENSMUSP00000134185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]
Predicted Effect probably benign
Transcript: ENSMUST00000172737
AA Change: T200A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133508
Gene: ENSMUSG00000037627
AA Change: T200A

Blast:RGS 231 262 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172831
AA Change: T815A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: T815A

low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174881
AA Change: T691A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: T691A

low complexity region 23 37 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
RGS 721 849 3.15e-2 SMART
RGS 890 1010 1.56e-15 SMART
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 splice site probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36099788 missense probably benign 0.04
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36106955 missense probably benign 0.00
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6295:Rgs22 UTSW 15 36087374 missense probably benign 0.00
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36010747 missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36015643 missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36040710 missense probably benign 0.08
R7732:Rgs22 UTSW 15 36025981 missense probably damaging 1.00
R7748:Rgs22 UTSW 15 36122269 critical splice donor site probably null
R7771:Rgs22 UTSW 15 36050078 missense possibly damaging 0.94
R7835:Rgs22 UTSW 15 36081911 critical splice donor site probably null
R7849:Rgs22 UTSW 15 36099712 missense probably damaging 1.00
R7954:Rgs22 UTSW 15 36082002 missense possibly damaging 0.75
R8384:Rgs22 UTSW 15 36046012 critical splice donor site probably null
R8516:Rgs22 UTSW 15 36010335 makesense probably null
RF035:Rgs22 UTSW 15 36010835 critical splice acceptor site probably benign
RF043:Rgs22 UTSW 15 36010836 critical splice acceptor site probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-02