Mutagenetix > Incidental Mutation

Incidental Mutation 'R2208:Sntb1'

236797

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

040210-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R2208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55906318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 92 (T92A)

Ref Sequence

ENSEMBL: ENSMUSP00000105829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000110200]

AlphaFold

Q99L88

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039769
AA Change: T92A

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: T92A

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110200
AA Change: T92A

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105829
Gene: ENSMUSG00000060429
AA Change: T92A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
PDZ	120	194	4.5e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140574

Meta Mutation Damage Score

0.0648

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,194,403	N883K	probably benign	Het
Ahnak	T	C	19: 9,017,732	V5460A	probably benign	Het
Bco2	A	G	9: 50,533,455	V517A	probably damaging	Het
Brca2	T	A	5: 150,532,344	D183E	probably damaging	Het
Ccdc142	T	C	6: 83,107,960		probably null	Het
Ccdc39	A	G	3: 33,841,178	L34P	probably damaging	Het
Cdc42bpb	T	A	12: 111,336,029	H198L	probably damaging	Het
Cdc73	T	A	1: 143,609,382	E516V	probably damaging	Het
Cep170b	T	A	12: 112,738,985	L1059Q	probably benign	Het
Chrm1	T	C	19: 8,678,099	L56P	probably damaging	Het
Clec4d	T	A	6: 123,265,355	V22D	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp2d12	T	C	15: 82,556,936	L141P	probably damaging	Het
Cyp4x1	G	T	4: 115,126,594	Q85K	probably benign	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Enpp7	T	C	11: 118,988,762		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fitm2	T	A	2: 163,472,684		probably benign	Het
Gm14139	T	A	2: 150,193,145	V462E	probably benign	Het
Gng10	T	A	4: 59,035,314	I26N	possibly damaging	Het
Gpr33	C	T	12: 52,023,453	V268I	probably benign	Het
Hmcn2	G	A	2: 31,380,297	C1182Y	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Krt36	C	T	11: 100,102,939	V358M	probably damaging	Het
Lmod3	T	C	6: 97,247,877	I328V	probably benign	Het
Lrp8	T	C	4: 107,855,790	V580A	probably damaging	Het
Masp2	T	C	4: 148,614,415	I651T	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Msi2	A	T	11: 88,590,108	S118T	probably damaging	Het
Muc19	T	C	15: 91,871,549		noncoding transcript	Het
Nabp1	G	A	1: 51,477,614	R32*	probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nup88	T	C	11: 70,965,719	D196G	probably damaging	Het
Olfr747	T	C	14: 50,681,563	I24V	probably benign	Het
Pax1	T	A	2: 147,365,802	I198N	probably damaging	Het
Pde3a	A	G	6: 141,250,347	E253G	probably damaging	Het
Phldb1	C	T	9: 44,696,131	R1192Q	probably damaging	Het
Pianp	C	A	6: 124,999,639	P137Q	probably damaging	Het
Prdm15	A	C	16: 97,799,264		probably null	Het
Ptprf	A	T	4: 118,269,172		probably benign	Het
Rfx7	A	G	9: 72,617,964	D812G	probably benign	Het
Rgs22	T	C	15: 36,050,232	T691A	probably benign	Het
Rundc3a	A	T	11: 102,402,088	S436C	probably damaging	Het
Tarsl2	T	C	7: 65,682,848	S566P	probably damaging	Het
Tbc1d32	A	T	10: 56,150,792		probably null	Het
Tep1	T	C	14: 50,866,864	Q191R	probably benign	Het
Tmc2	C	A	2: 130,214,563		probably null	Het
Tns1	A	C	1: 74,079,240	I77S	probably damaging	Het
Trpd52l3	T	C	19: 30,004,246	W134R	probably damaging	Het
Vmn2r15	A	C	5: 109,297,443	N38K	possibly damaging	Het
Wdr90	A	T	17: 25,860,388	D257E	probably damaging	Het
Zbtb9	T	C	17: 26,974,124	C168R	possibly damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCACCGACAGGATGGCATC -3'
(R):5'- GGGATCGCTGGCATAAAGTTC -3'

Sequencing Primer
(F):5'- ACATACAGGGCTTGGGTCTGATC -3'
(R):5'- TCTGGTGAACTTGAGCGAGGAC -3'

Posted On

2014-10-02