Incidental Mutation 'R2208:Zbtb9'
ID 236801
Institutional Source Beutler Lab
Gene Symbol Zbtb9
Ensembl Gene ENSMUSG00000079605
Gene Name zinc finger and BTB domain containing 9
Synonyms 3930402F13Rik
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27192153-27195177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27193098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 168 (C168R)
Ref Sequence ENSEMBL: ENSMUSP00000112778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000120016] [ENSMUST00000133257] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000229490] [ENSMUST00000201702] [ENSMUST00000231853] [ENSMUST00000228963]
AlphaFold Q8CDC7
Predicted Effect probably benign
Transcript: ENSMUST00000081285
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120016
AA Change: C168R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112778
Gene: ENSMUSG00000079605
AA Change: C168R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
BTB 48 142 4.08e-21 SMART
low complexity region 144 164 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
ZnF_C2H2 397 419 1.36e-2 SMART
ZnF_C2H2 424 444 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231853
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably benign
Transcript: ENSMUST00000228963
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Zbtb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Zbtb9 APN 17 27,193,985 (GRCm39) unclassified probably benign
IGL02266:Zbtb9 APN 17 27,193,129 (GRCm39) missense probably benign 0.00
IGL03192:Zbtb9 APN 17 27,193,272 (GRCm39) missense probably benign 0.01
PIT4377001:Zbtb9 UTSW 17 27,193,735 (GRCm39) missense probably damaging 1.00
R0655:Zbtb9 UTSW 17 27,193,074 (GRCm39) missense probably damaging 1.00
R1350:Zbtb9 UTSW 17 27,193,380 (GRCm39) missense probably benign 0.05
R1386:Zbtb9 UTSW 17 27,193,612 (GRCm39) missense probably damaging 1.00
R1928:Zbtb9 UTSW 17 27,193,612 (GRCm39) missense probably damaging 1.00
R2035:Zbtb9 UTSW 17 27,193,897 (GRCm39) missense probably damaging 1.00
R4196:Zbtb9 UTSW 17 27,192,853 (GRCm39) missense probably benign 0.20
R7202:Zbtb9 UTSW 17 27,193,666 (GRCm39) missense probably damaging 1.00
R8225:Zbtb9 UTSW 17 27,193,759 (GRCm39) missense probably damaging 1.00
R8544:Zbtb9 UTSW 17 27,193,448 (GRCm39) nonsense probably null
R9688:Zbtb9 UTSW 17 27,193,894 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTACCGAATGTCATCGAGGCC -3'
(R):5'- AAAGAGTGGAGCTGCTGACC -3'

Sequencing Primer
(F):5'- CAGCTCATTTATTCAGGAAGCC -3'
(R):5'- AGCTGCTGACCCCTGCTC -3'
Posted On 2014-10-02