Incidental Mutation 'R2208:Chrm1'
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Namecholinergic receptor, muscarinic 1, CNS
Synonymsmuscarinic acetylcholine receptor 1, M1R, M1, AW495047, Chrm-1
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosomal Location8663789-8683587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8678099 bp
Amino Acid Change Leucine to Proline at position 56 (L56P)
Ref Sequence ENSEMBL: ENSMUSP00000135356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
Predicted Effect probably damaging
Transcript: ENSMUST00000035444
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: L56P

Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect probably damaging
Transcript: ENSMUST00000163785
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: L56P

Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177197
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773
AA Change: L56P

Pfam:7tm_1 42 74 1.6e-9 PFAM
Meta Mutation Damage Score 0.9558 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8678074 missense probably benign 0.01
IGL01633:Chrm1 APN 19 8678495 missense probably benign 0.29
IGL01824:Chrm1 APN 19 8679130 missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8678311 missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8679308 missense probably benign 0.33
Flystone UTSW 19 8679154 missense possibly damaging 0.93
R1660:Chrm1 UTSW 19 8679218 missense possibly damaging 0.53
R1942:Chrm1 UTSW 19 8678273 missense probably damaging 0.99
R6466:Chrm1 UTSW 19 8678178 nonsense probably null
R6535:Chrm1 UTSW 19 8679073 missense possibly damaging 0.93
R6720:Chrm1 UTSW 19 8678548 missense probably benign 0.00
R8061:Chrm1 UTSW 19 8679154 missense possibly damaging 0.93
R8262:Chrm1 UTSW 19 8679089 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-02