Incidental Mutation 'R2208:Chrm1'
ID 236803
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Name cholinergic receptor, muscarinic 1, CNS
Synonyms Chrm-1, AW495047, M1R, muscarinic acetylcholine receptor 1, M1
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 8641369-8660970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8655463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 56 (L56P)
Ref Sequence ENSEMBL: ENSMUSP00000135356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
AlphaFold P12657
Predicted Effect probably damaging
Transcript: ENSMUST00000035444
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: L56P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect probably damaging
Transcript: ENSMUST00000163785
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: L56P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177197
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773
AA Change: L56P

DomainStartEndE-ValueType
Pfam:7tm_1 42 74 1.6e-9 PFAM
Meta Mutation Damage Score 0.9558 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8,655,438 (GRCm39) missense probably benign 0.01
IGL01633:Chrm1 APN 19 8,655,859 (GRCm39) missense probably benign 0.29
IGL01824:Chrm1 APN 19 8,656,494 (GRCm39) missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8,655,675 (GRCm39) missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8,656,672 (GRCm39) missense probably benign 0.33
Flystone UTSW 19 8,656,518 (GRCm39) missense possibly damaging 0.93
R1660:Chrm1 UTSW 19 8,656,582 (GRCm39) missense possibly damaging 0.53
R1942:Chrm1 UTSW 19 8,655,637 (GRCm39) missense probably damaging 0.99
R6466:Chrm1 UTSW 19 8,655,542 (GRCm39) nonsense probably null
R6535:Chrm1 UTSW 19 8,656,437 (GRCm39) missense possibly damaging 0.93
R6720:Chrm1 UTSW 19 8,655,912 (GRCm39) missense probably benign 0.00
R8061:Chrm1 UTSW 19 8,656,518 (GRCm39) missense possibly damaging 0.93
R8262:Chrm1 UTSW 19 8,656,453 (GRCm39) missense probably damaging 0.98
R9004:Chrm1 UTSW 19 8,655,909 (GRCm39) missense possibly damaging 0.88
R9443:Chrm1 UTSW 19 8,655,550 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACCTGGCTGCAATGAACACC -3'
(R):5'- GGTCGGGTCACTGAGAAGTAAC -3'

Sequencing Primer
(F):5'- CTCAGTGCCCCCTGCTG -3'
(R):5'- AAGATTCATGACAGAGGCGTTGC -3'
Posted On 2014-10-02