Incidental Mutation 'R2175:Hdac1'
ID236815
Institutional Source Beutler Lab
Gene Symbol Hdac1
Ensembl Gene ENSMUSG00000028800
Gene Namehistone deacetylase 1
SynonymsHD1, MommeD5, RPD3
MMRRC Submission 040177-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2175 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129516104-129542713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129534670 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 36 (R36C)
Ref Sequence ENSEMBL: ENSMUSP00000099657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102597]
Predicted Effect probably damaging
Transcript: ENSMUST00000102597
AA Change: R36C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099657
Gene: ENSMUSG00000028800
AA Change: R36C

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 5.3e-86 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139305
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos between E9.5 and E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Alox8 T C 11: 69,187,766 Y367C possibly damaging Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cox10 G A 11: 64,071,649 A122V probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Fam151b T C 13: 92,477,918 R21G probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Nkx1-1 G A 5: 33,431,254 A230V probably benign Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Smarcc1 A T 9: 110,164,809 T241S possibly damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Hdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03169:Hdac1 APN 4 129518831 missense probably null 0.08
R0783:Hdac1 UTSW 4 129518109 missense probably benign 0.06
R1771:Hdac1 UTSW 4 129521428 missense probably damaging 1.00
R1985:Hdac1 UTSW 4 129528960 missense possibly damaging 0.86
R2119:Hdac1 UTSW 4 129522364 missense probably benign 0.00
R2415:Hdac1 UTSW 4 129522961 critical splice donor site probably null
R3809:Hdac1 UTSW 4 129524320 missense probably damaging 1.00
R5243:Hdac1 UTSW 4 129516853 intron probably benign
R5276:Hdac1 UTSW 4 129528923 splice site probably null
R6274:Hdac1 UTSW 4 129519109 missense probably damaging 1.00
R6843:Hdac1 UTSW 4 129542590 missense probably damaging 1.00
R7599:Hdac1 UTSW 4 129517466 nonsense probably null
R7816:Hdac1 UTSW 4 129518095 missense probably damaging 0.99
Z1176:Hdac1 UTSW 4 129542616 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCACTGAATGAATGAGCAGCTGAG -3'
(R):5'- TTACAAACCGGAGAACCTGGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- ATCCCAGTACTTGGCAGAGTTAG -3'
Posted On2014-10-02