Incidental Mutation 'R2175:Nkx1-1'
ID236819
Institutional Source Beutler Lab
Gene Symbol Nkx1-1
Ensembl Gene ENSMUSG00000029112
Gene NameNK1 homeobox 1
SynonymsNkx-1.1, Sax2
MMRRC Submission 040177-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R2175 (G1)
Quality Score186
Status Not validated
Chromosome5
Chromosomal Location33430734-33433976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33431254 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 230 (A230V)
Ref Sequence ENSEMBL: ENSMUSP00000133620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173348]
Predicted Effect probably benign
Transcript: ENSMUST00000173348
AA Change: A230V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133620
Gene: ENSMUSG00000029112
AA Change: A230V

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 94 120 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 166 187 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
HOX 250 312 2.74e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show poor growth and survival. Most die within the first three weeks of life. Those that reach adulthood are fertile but do not produce viable offspring. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Alox8 T C 11: 69,187,766 Y367C possibly damaging Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cox10 G A 11: 64,071,649 A122V probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Fam151b T C 13: 92,477,918 R21G probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Hdac1 G A 4: 129,534,670 R36C probably damaging Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Smarcc1 A T 9: 110,164,809 T241S possibly damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Nkx1-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1826:Nkx1-1 UTSW 5 33433933 missense unknown
R3735:Nkx1-1 UTSW 5 33433730 missense unknown
R4973:Nkx1-1 UTSW 5 33431066 missense possibly damaging 0.89
R6155:Nkx1-1 UTSW 5 33431051 missense probably damaging 1.00
R6322:Nkx1-1 UTSW 5 33431045 missense probably damaging 1.00
R6381:Nkx1-1 UTSW 5 33433976 start codon destroyed probably null
R6675:Nkx1-1 UTSW 5 33433879 missense unknown
R6831:Nkx1-1 UTSW 5 33433803 missense unknown
Z1177:Nkx1-1 UTSW 5 33431495 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATCTTCACCTGCGTCTCG -3'
(R):5'- AAAAGAGAATCTCTCCTGGGGC -3'

Sequencing Primer
(F):5'- TTCACCTGCGTCTCGGTGAG -3'
(R):5'- CAGGTGCTGGGGACTCTTACAG -3'
Posted On2014-10-02