Incidental Mutation 'R2175:Alox8'
ID236835
Institutional Source Beutler Lab
Gene Symbol Alox8
Ensembl Gene ENSMUSG00000020891
Gene Namearachidonate 8-lipoxygenase
Synonyms8-LOX, 8S-lipoxygenase, 8S-LOX, Alox15b
MMRRC Submission 040177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2175 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69183932-69197843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69187766 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 367 (Y367C)
Ref Sequence ENSEMBL: ENSMUSP00000091621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021262] [ENSMUST00000094078]
Predicted Effect probably benign
Transcript: ENSMUST00000021262
AA Change: Y367C

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021262
Gene: ENSMUSG00000020891
AA Change: Y367C

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 163 662 5.5e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094078
AA Change: Y367C

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091621
Gene: ENSMUSG00000020891
AA Change: Y367C

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 205 405 6.9e-44 PFAM
Pfam:Lipoxygenase 402 640 1.9e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the lipoxygenase (LOX) gene family whose members encode enzymes that catalyze the addition of molecular oxygen to polyunsaturated fatty acids (PUFAs) to yield fatty acid hydroperoxides. The encoded enzyme preferentially metabolizes arachidonic acid to yield 8-hydroxyeicosatetraenoic acid (8-HETE), while metabolizing linoleic acid less efficiently. The gene may also function as a tumor suppressor. This gene is located in a cluster of related genes that spans approximately 75 kilobases on chromosome 11. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cox10 G A 11: 64,071,649 A122V probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Fam151b T C 13: 92,477,918 R21G probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Hdac1 G A 4: 129,534,670 R36C probably damaging Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Nkx1-1 G A 5: 33,431,254 A230V probably benign Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Smarcc1 A T 9: 110,164,809 T241S possibly damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Alox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Alox8 APN 11 69188690 missense probably benign
IGL01878:Alox8 APN 11 69197038 missense probably benign 0.00
IGL02342:Alox8 APN 11 69186227 missense probably damaging 1.00
IGL02694:Alox8 APN 11 69186629 missense probably damaging 0.99
IGL03246:Alox8 APN 11 69186015 missense probably damaging 1.00
IGL03373:Alox8 APN 11 69186617 missense probably benign 0.00
R0567:Alox8 UTSW 11 69191522 critical splice donor site probably null
R1575:Alox8 UTSW 11 69185241 missense possibly damaging 0.94
R1688:Alox8 UTSW 11 69189906 missense probably benign 0.01
R2021:Alox8 UTSW 11 69186288 missense probably damaging 0.98
R2041:Alox8 UTSW 11 69197691 missense possibly damaging 0.67
R2237:Alox8 UTSW 11 69185771 missense probably benign 0.00
R3821:Alox8 UTSW 11 69186482 missense probably damaging 0.98
R4870:Alox8 UTSW 11 69186568 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69186505 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69189889 missense possibly damaging 0.82
R7003:Alox8 UTSW 11 69191590 missense possibly damaging 0.70
R7158:Alox8 UTSW 11 69185870 missense probably benign 0.00
R7316:Alox8 UTSW 11 69186238 missense probably benign 0.01
R7513:Alox8 UTSW 11 69187844 missense probably benign 0.34
X0065:Alox8 UTSW 11 69185253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTATGGGATTGGCTGCAGG -3'
(R):5'- CCAGGTCTGTAAGAAGGCAG -3'

Sequencing Primer
(F):5'- GTAGGTCCCAAAGTCATTGTGATCC -3'
(R):5'- CAATGGCAGAGTACAGAGGGTCC -3'
Posted On2014-10-02