Incidental Mutation 'R2175:Fam151b'
ID236841
Institutional Source Beutler Lab
Gene Symbol Fam151b
Ensembl Gene ENSMUSG00000034334
Gene Namefamily with sequence similarity 151, member B
Synonyms4930405M20Rik
MMRRC Submission 040177-MU
Accession Numbers

NCBI RefSeq: NM_001163627.1; MGI:1921192

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2175 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location92449625-92484015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92477918 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 21 (R21G)
Ref Sequence ENSEMBL: ENSMUSP00000153204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040106] [ENSMUST00000225299]
Predicted Effect probably benign
Transcript: ENSMUST00000040106
AA Change: R21G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000045024
Gene: ENSMUSG00000034334
AA Change: R21G

DomainStartEndE-ValueType
Pfam:DUF2181 29 263 2.3e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225299
AA Change: R21G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Alox8 T C 11: 69,187,766 Y367C possibly damaging Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cox10 G A 11: 64,071,649 A122V probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Hdac1 G A 4: 129,534,670 R36C probably damaging Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Nkx1-1 G A 5: 33,431,254 A230V probably benign Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Smarcc1 A T 9: 110,164,809 T241S possibly damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Fam151b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Fam151b APN 13 92477853 missense probably damaging 1.00
IGL02253:Fam151b APN 13 92477927 missense probably damaging 1.00
IGL03084:Fam151b APN 13 92468026 missense probably damaging 0.97
IGL03130:Fam151b APN 13 92450193 missense probably benign 0.01
P0015:Fam151b UTSW 13 92467944 critical splice donor site probably null
R0067:Fam151b UTSW 13 92473996 missense probably benign 0.08
R0067:Fam151b UTSW 13 92473996 missense probably benign 0.08
R0348:Fam151b UTSW 13 92450181 missense probably benign 0.00
R1404:Fam151b UTSW 13 92473972 missense probably damaging 1.00
R1404:Fam151b UTSW 13 92473972 missense probably damaging 1.00
R1482:Fam151b UTSW 13 92450166 missense probably benign 0.03
R1837:Fam151b UTSW 13 92474131 intron probably benign
R1891:Fam151b UTSW 13 92450170 missense probably benign 0.00
R1957:Fam151b UTSW 13 92477902 missense probably damaging 1.00
R1957:Fam151b UTSW 13 92477903 missense probably damaging 1.00
R4583:Fam151b UTSW 13 92468109 missense probably damaging 1.00
R6762:Fam151b UTSW 13 92468050 missense possibly damaging 0.79
X0021:Fam151b UTSW 13 92450226 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTCAAGACATTCTGCTTGG -3'
(R):5'- AATGGTTATCTACGAGATGATGGG -3'

Sequencing Primer
(F):5'- TCACAAGTTTGAGGCTAGCC -3'
(R):5'- ATCTACGAGATGATGGGTATGC -3'
Posted On2014-10-02