Mutagenetix > Incidental Mutation

Incidental Mutation 'R2175:Ext1'

236843

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

040177-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2175 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 53068728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 726 (P726Q)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably damaging
Transcript: ENSMUST00000077273
AA Change: P726Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: P726Q

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra2a	A	G	19: 54,046,362	T50A	probably benign	Het
Alox8	T	C	11: 69,187,766	Y367C	possibly damaging	Het
Ankfn1	A	G	11: 89,526,537	L83P	probably damaging	Het
Asxl3	T	C	18: 22,516,595	L547P	probably benign	Het
Cox10	G	A	11: 64,071,649	A122V	probably benign	Het
Cttnbp2	A	C	6: 18,434,829		probably null	Het
Eml5	A	T	12: 98,876,223	C205*	probably null	Het
Ephx3	T	A	17: 32,188,459	T204S	possibly damaging	Het
Evi5l	A	G	8: 4,187,269	H124R	probably damaging	Het
Fam151b	T	C	13: 92,477,918	R21G	probably damaging	Het
Gm5346	T	A	8: 43,625,438	Y583F	probably benign	Het
Hdac1	G	A	4: 129,534,670	R36C	probably damaging	Het
Ift172	A	G	5: 31,266,685	Y715H	probably damaging	Het
Inpp4b	T	C	8: 81,856,699	F144S	probably damaging	Het
Lepr	T	A	4: 101,765,379	I452N	probably benign	Het
Mok	T	C	12: 110,815,200	H6R	probably benign	Het
Myef2	A	T	2: 125,098,455	M392K	probably damaging	Het
Ncoa2	G	A	1: 13,224,613	P28S	probably damaging	Het
Nfrkb	A	G	9: 31,389,014	T34A	possibly damaging	Het
Nkx1-1	G	A	5: 33,431,254	A230V	probably benign	Het
Olfr1123	T	A	2: 87,418,156	L34H	probably damaging	Het
Olfr1437	T	A	19: 12,322,521	Y102F	probably damaging	Het
Ryr1	T	G	7: 29,068,442	K2890T	probably damaging	Het
Siae	G	T	9: 37,627,796	D168Y	probably damaging	Het
Smarcc1	A	T	9: 110,164,809	T241S	possibly damaging	Het
Steap2	T	A	5: 5,673,501	I460F	probably damaging	Het
Strap	A	G	6: 137,750,592	T345A	probably benign	Het
Tex2	A	G	11: 106,503,687	V1099A	unknown	Het
Thsd7a	T	C	6: 12,331,944	T1290A	possibly damaging	Het
Unc80	G	A	1: 66,677,355	G2878D	probably damaging	Het
Vmn2r63	C	T	7: 42,933,580		probably null	Het
Xirp2	C	T	2: 67,509,914	T833I	probably damaging	Het
Zcchc2	T	C	1: 106,027,423	S615P	probably damaging	Het
Zfp148	C	G	16: 33,496,746	S554*	probably null	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATACTTGGCACAGTCTGGC -3'
(R):5'- ACACGTTCTGCCAGGTTCTG -3'

Sequencing Primer
(F):5'- ACAGTCTGGCTCCACTGCTG -3'
(R):5'- GGTCTTTAGCAGATCCAGCTACAG -3'

Posted On

2014-10-02