Mutagenetix > Incidental Mutation

Incidental Mutation 'R0201:Asxl3'

23685

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

038458-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R0201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22523154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1407 (V1407A)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000097655
AA Change: V1407A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: V1407A

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120223
AA Change: V1407A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: V1407A

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

97% (91/94)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,581,957		probably null	Het
Adamts16	T	A	13: 70,779,644	Q492L	possibly damaging	Het
Aplnr	A	G	2: 85,137,177	D182G	probably damaging	Het
Arnt2	G	T	7: 84,361,659	S3*	probably null	Het
Atg13	A	T	2: 91,684,762		probably null	Het
Atm	A	T	9: 53,454,279		probably benign	Het
Birc6	T	G	17: 74,609,327	V1746G	possibly damaging	Het
Cbln1	G	T	8: 87,472,113	T43K	probably benign	Het
Cbx5	T	C	15: 103,199,700	T173A	probably damaging	Het
Cc2d2a	A	G	5: 43,737,512	Y1437C	probably damaging	Het
Ccdc78	C	A	17: 25,789,236		probably benign	Het
Cd2bp2	A	G	7: 127,193,828	Y341H	probably damaging	Het
Cdhr5	T	A	7: 141,276,378	D88V	probably damaging	Het
Ces1f	T	A	8: 93,267,329	T275S	probably null	Het
Clca4a	T	C	3: 144,960,717	N458S	probably benign	Het
Cog5	A	G	12: 31,839,841	K521R	probably damaging	Het
Csf2ra	T	A	19: 61,225,568	T305S	probably benign	Het
Csmd3	T	A	15: 47,619,729		probably benign	Het
Cts6	T	A	13: 61,201,499	R132*	probably null	Het
D5Ertd579e	G	T	5: 36,616,465	N195K	probably damaging	Het
Ddx1	A	G	12: 13,223,808	V606A	probably damaging	Het
Dip2b	G	A	15: 100,186,147	D884N	probably damaging	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Enpp1	T	A	10: 24,653,917	T608S	probably benign	Het
Fancm	T	C	12: 65,101,632	Y674H	probably damaging	Het
Fat4	T	A	3: 38,891,596	V1546D	probably damaging	Het
Fsd1	G	A	17: 55,990,522	A158T	probably benign	Het
Fzd2	T	A	11: 102,606,122	M464K	probably damaging	Het
Gjc2	A	G	11: 59,177,590	F22S	possibly damaging	Het
Gm13101	T	C	4: 143,964,890	E421G	probably damaging	Het
Gria2	T	C	3: 80,707,838	Y445C	probably damaging	Het
Hsdl1	T	A	8: 119,566,256	I147F	possibly damaging	Het
Ifi44	T	C	3: 151,745,636	Y226C	probably damaging	Het
Il16	A	G	7: 83,722,308	C97R	probably damaging	Het
Impg1	A	T	9: 80,345,561	S369T	probably damaging	Het
Jmjd1c	A	G	10: 67,219,109	T390A	unknown	Het
Lgi1	A	G	19: 38,301,293	E269G	possibly damaging	Het
Lrp6	G	T	6: 134,450,897	Y1577*	probably null	Het
Lrrc74a	G	T	12: 86,761,773		probably benign	Het
Man1c1	A	T	4: 134,640,398		probably null	Het
Map1lc3b	A	C	8: 121,590,550	Q9P	possibly damaging	Het
Mboat1	G	A	13: 30,202,375	R124H	probably benign	Het
Mcu	A	G	10: 59,456,677	L60P	probably damaging	Het
Mrs2	G	T	13: 25,018,534	Q75K	probably benign	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Neb	G	A	2: 52,206,878		probably benign	Het
Nlrp2	C	T	7: 5,328,329	G356D	probably benign	Het
Notch3	A	G	17: 32,156,148		probably benign	Het
Npr2	A	C	4: 43,641,617	S474R	probably damaging	Het
Nupl1	A	G	14: 60,244,616	F100L	probably benign	Het
Osbpl6	A	C	2: 76,546,042	D87A	possibly damaging	Het
Pabpc2	A	T	18: 39,775,307	M542L	probably benign	Het
Papln	A	G	12: 83,783,027		probably benign	Het
Parpbp	T	C	10: 88,092,896	I561V	possibly damaging	Het
Pcdhb13	C	T	18: 37,442,581	A4V	probably benign	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Poldip3	T	A	15: 83,135,296	M182L	probably benign	Het
Por	T	C	5: 135,731,178	S240P	possibly damaging	Het
Pramef20	A	T	4: 144,377,273		probably benign	Het
Prss22	A	T	17: 23,996,301	V167D	probably damaging	Het
Prss37	A	C	6: 40,516,349	L61R	probably damaging	Het
Psmd1	C	T	1: 86,118,616	T702M	probably benign	Het
Pxdn	G	T	12: 30,002,431	G869V	possibly damaging	Het
Rabgap1l	A	G	1: 160,453,745		probably benign	Het
Rapgef6	T	C	11: 54,619,941	V228A	probably damaging	Het
Rnf169	T	C	7: 99,926,003	R462G	possibly damaging	Het
Rnft2	A	G	5: 118,194,680		probably benign	Het
Sgo2b	T	C	8: 63,926,636	D1054G	probably benign	Het
Sh3bgr	T	C	16: 96,228,517		probably benign	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Spty2d1	G	A	7: 46,997,901	R427*	probably null	Het
Ssc5d	A	G	7: 4,944,663	T1339A	probably benign	Het
Sspo	A	C	6: 48,455,752	E854A	possibly damaging	Het
Stx7	A	G	10: 24,185,079		probably benign	Het
Styk1	A	T	6: 131,301,730		probably benign	Het
Tex33	T	A	15: 78,378,828	M209L	probably damaging	Het
Tmem163	T	G	1: 127,668,637		probably benign	Het
Tmppe	C	CT	9: 114,404,639		probably null	Het
Tmx2	A	G	2: 84,673,082	V229A	probably benign	Het
Top2b	T	C	14: 16,383,174	L54P	probably damaging	Het
Trim62	A	T	4: 128,902,550	Y280F	probably benign	Het
Tssk4	A	T	14: 55,651,559	K181*	probably null	Het
Tssk4	A	T	14: 55,651,560	K181M	probably damaging	Het
Ubn1	A	G	16: 5,064,614	D313G	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9047:Asxl3	UTSW	18	22452414	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGTACACTTCTGTGCCAGCTC -3'
(R):5'- ATGGATACGTCTGTCCTCACCGAC -3'

Sequencing Primer
(F):5'- GTTTCTGAGAAGATAGCCATGCC -3'
(R):5'- CCTAGTCTGGGAATCCAAACTTG -3'

Posted On

2013-04-16