Incidental Mutation 'R2176:Armc9'
ID236850
Institutional Source Beutler Lab
Gene Symbol Armc9
Ensembl Gene ENSMUSG00000062590
Gene Namearmadillo repeat containing 9
Synonyms5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86154780-86278284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86199892 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 83 (L83P)
Ref Sequence ENSEMBL: ENSMUSP00000116908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000150059] [ENSMUST00000156675]
Predicted Effect probably damaging
Transcript: ENSMUST00000027434
AA Change: L511P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590
AA Change: L511P

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113309
AA Change: L511P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590
AA Change: L511P

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123618
Predicted Effect probably damaging
Transcript: ENSMUST00000131412
AA Change: L511P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590
AA Change: L511P

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135973
Predicted Effect probably damaging
Transcript: ENSMUST00000150059
AA Change: L83P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590
AA Change: L83P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 168 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155168
Predicted Effect probably benign
Transcript: ENSMUST00000156675
SMART Domains Protein: ENSMUSP00000119749
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
SCOP:d1qbkb_ 6 100 3e-3 SMART
Meta Mutation Damage Score 0.9518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Armc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Armc9 APN 1 86198339 missense probably damaging 1.00
IGL00771:Armc9 APN 1 86199835 splice site probably null
IGL01689:Armc9 APN 1 86274418 missense probably benign
IGL02143:Armc9 APN 1 86176865 missense possibly damaging 0.58
IGL02680:Armc9 APN 1 86252278 missense probably damaging 1.00
IGL02812:Armc9 APN 1 86244571 missense probably damaging 0.99
IGL02887:Armc9 APN 1 86164835 missense probably damaging 1.00
IGL03011:Armc9 APN 1 86199916 critical splice donor site probably null
IGL03309:Armc9 APN 1 86274433 missense possibly damaging 0.54
R0184:Armc9 UTSW 1 86198370 missense probably damaging 1.00
R0440:Armc9 UTSW 1 86194262 splice site probably null
R0787:Armc9 UTSW 1 86202505 missense probably damaging 0.99
R0849:Armc9 UTSW 1 86257270 missense probably benign 0.00
R1687:Armc9 UTSW 1 86156955 start codon destroyed probably null 1.00
R1962:Armc9 UTSW 1 86207974 missense probably damaging 1.00
R3418:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R3419:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R4079:Armc9 UTSW 1 86213129 intron probably benign
R4112:Armc9 UTSW 1 86188939 missense possibly damaging 0.80
R4151:Armc9 UTSW 1 86164775 missense probably damaging 1.00
R4675:Armc9 UTSW 1 86202518 missense probably damaging 1.00
R4934:Armc9 UTSW 1 86213079 missense probably damaging 1.00
R4944:Armc9 UTSW 1 86274534 missense probably damaging 0.98
R5069:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5070:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5071:Armc9 UTSW 1 86186116 missense probably benign 0.01
R5238:Armc9 UTSW 1 86199847 missense probably benign 0.01
R5386:Armc9 UTSW 1 86198289 missense probably null 1.00
R5459:Armc9 UTSW 1 86207972 missense probably damaging 0.97
R6027:Armc9 UTSW 1 86244667 missense probably damaging 1.00
R6144:Armc9 UTSW 1 86244579 missense probably benign 0.06
R7111:Armc9 UTSW 1 86159995 missense probably damaging 1.00
R7237:Armc9 UTSW 1 86164849 missense possibly damaging 0.82
R7304:Armc9 UTSW 1 86162715 missense probably benign
R7452:Armc9 UTSW 1 86213092 missense possibly damaging 0.87
R7555:Armc9 UTSW 1 86275678 missense probably damaging 1.00
R7805:Armc9 UTSW 1 86196319 missense probably damaging 1.00
R8513:Armc9 UTSW 1 86162683 missense probably damaging 1.00
Z1177:Armc9 UTSW 1 86176825 missense probably damaging 0.97
Z1177:Armc9 UTSW 1 86196355 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCACTACCAGCTTCTGAG -3'
(R):5'- TGCAAAAGACCCTCAAATCTAGG -3'

Sequencing Primer
(F):5'- ATGTAACCCTGACTGTCCTGGAG -3'
(R):5'- CATAAGAGGTCAGCCTCT -3'
Posted On2014-10-02