Mutagenetix > Incidental Mutation

Incidental Mutation 'R2176:Rgsl1'

236852

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

040178-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 153825268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

probably benign
Transcript: ENSMUST00000124558

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,259,367		probably benign	Het
Adam1a	T	A	5: 121,519,586	Y548F	probably benign	Het
Armc9	T	C	1: 86,199,892	L83P	probably damaging	Het
BC051665	A	T	13: 60,784,530		probably benign	Het
Casp3	A	G	8: 46,629,756	N3S	probably damaging	Het
Ccdc174	G	A	6: 91,888,089	M109I	probably benign	Het
Ccr6	T	A	17: 8,256,241	F93I	probably damaging	Het
Clvs2	T	C	10: 33,595,815	S165G	probably damaging	Het
Cntnap5c	T	C	17: 58,013,946	V171A	probably benign	Het
Dennd5a	C	A	7: 109,905,120		probably null	Het
Dock2	T	A	11: 34,695,217	Y546F	probably benign	Het
Fat2	A	G	11: 55,267,575		probably null	Het
Focad	T	A	4: 88,279,244	Y625N	unknown	Het
Fyb	A	G	15: 6,579,954	K3E	probably damaging	Het
Gm14496	G	A	2: 181,991,337	D38N	probably benign	Het
Gm20403	T	C	12: 54,986,370	T54A	probably benign	Het
Gm9830	A	G	9: 44,464,259		noncoding transcript	Het
Hectd1	A	T	12: 51,745,494	S2487R	probably damaging	Het
Il5ra	A	G	6: 106,738,272	L175S	probably benign	Het
Itgav	C	T	2: 83,803,255	R983C	probably damaging	Het
Kcna10	T	C	3: 107,194,716	V221A	probably damaging	Het
Kif13b	G	A	14: 64,669,671	V35I	probably benign	Het
Kif6	G	A	17: 49,755,230	E473K	probably damaging	Het
Mfsd14a	T	C	3: 116,632,393	T452A	probably benign	Het
Mllt1	A	G	17: 56,897,398	S382P	probably benign	Het
Myo15b	T	C	11: 115,866,572	W1083R	probably damaging	Het
Nell2	T	C	15: 95,435,157	I174V	probably damaging	Het
Noct	G	A	3: 51,249,696		probably null	Het
Nvl	A	T	1: 181,135,074		probably benign	Het
Ofcc1	T	C	13: 40,097,119	S574G	probably benign	Het
Olfr1248	A	T	2: 89,617,580	M204K	possibly damaging	Het
Olfr512	G	A	7: 108,714,132	V248I	probably damaging	Het
Olfr749	T	C	14: 50,736,224	M313V	probably benign	Het
Pip5k1a	A	T	3: 95,065,496	S415T	probably damaging	Het
Pkhd1	G	A	1: 20,553,517	P785S	probably damaging	Het
Plcg2	A	G	8: 117,612,994	Y1048C	probably damaging	Het
Ppp3cb	A	T	14: 20,520,652	V337E	probably benign	Het
Prkg2	T	C	5: 98,966,509		probably benign	Het
Prl7a2	T	G	13: 27,659,106	Y238S	probably benign	Het
Psg28	T	A	7: 18,427,879	D233V	probably damaging	Het
Rad50	A	G	11: 53,698,209	C221R	probably benign	Het
Rgl3	A	G	9: 21,975,958		probably benign	Het
Ror1	C	A	4: 100,441,874	R815S	probably damaging	Het
Rrp1b	C	A	17: 32,056,560	D360E	probably benign	Het
Ryr3	T	C	2: 112,666,335	Q3682R	possibly damaging	Het
Sdr42e1	A	T	8: 117,662,877	F342I	possibly damaging	Het
Setd5	A	G	6: 113,151,153	R1337G	probably benign	Het
Siglecf	T	C	7: 43,351,716	V36A	probably damaging	Het
Slc4a5	G	A	6: 83,262,560	G152D	probably damaging	Het
Sptbn4	T	G	7: 27,364,162	M2280L	probably benign	Het
Syngr2	T	C	11: 117,812,580	I74T	probably damaging	Het
Tm9sf1	T	C	14: 55,641,409	I175M	possibly damaging	Het
Tmc3	A	G	7: 83,609,308	E502G	probably damaging	Het
Tph1	T	A	7: 46,662,039	D88V	possibly damaging	Het
Tpr	A	G	1: 150,419,940	K979E	possibly damaging	Het
Usp47	A	G	7: 112,092,727	T799A	probably benign	Het
Utf1	A	G	7: 139,944,007	E45G	possibly damaging	Het
Vmn1r208	A	T	13: 22,772,602	C242S	probably damaging	Het
Wrnip1	T	C	13: 32,820,240	I498T	probably damaging	Het
Ypel2	T	A	11: 86,971,873	H18L	probably benign	Het
Zan	T	G	5: 137,421,848	D2849A	unknown	Het
Zfp647	A	T	15: 76,911,660	F267I	probably damaging	Het
Zfp786	G	T	6: 47,820,971	H344Q	possibly damaging	Het
Zswim3	G	T	2: 164,820,694	A365S	probably benign	Het
Zswim5	T	C	4: 116,973,041	W538R	probably damaging	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGCTTCCCAATGTCTAGTGC -3'
(R):5'- GGGAATGCACTCTTTCGTCAC -3'

Sequencing Primer
(F):5'- GACTTCCTTCAGTAAGATAGCCTGAG -3'
(R):5'- CGTCACATGCTTGGTAATCGAATCTG -3'

Posted On

2014-10-02