Incidental Mutation 'R2176:Mfsd14a'
ID 236862
Institutional Source Beutler Lab
Gene Symbol Mfsd14a
Ensembl Gene ENSMUSG00000089911
Gene Name major facilitator superfamily domain containing 14A
Synonyms Hiat1
MMRRC Submission 040178-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.548) question?
Stock # R2176 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 116424813-116456264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116426042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 452 (T452A)
Ref Sequence ENSEMBL: ENSMUSP00000029570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029570] [ENSMUST00000029571] [ENSMUST00000197335] [ENSMUST00000198311]
AlphaFold P70187
Predicted Effect probably benign
Transcript: ENSMUST00000029570
AA Change: T452A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029570
Gene: ENSMUSG00000089911
AA Change: T452A

DomainStartEndE-ValueType
Pfam:MFS_1 40 388 3.4e-33 PFAM
Pfam:MFS_2 182 407 3.6e-10 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029571
SMART Domains Protein: ENSMUSP00000029571
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:SAS-6_N 44 141 1.7e-29 PFAM
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197063
Predicted Effect probably benign
Transcript: ENSMUST00000197335
SMART Domains Protein: ENSMUSP00000143123
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
PDB:2Y3W|C 7 136 3e-48 PDB
low complexity region 188 200 N/A INTRINSIC
coiled coil region 380 436 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198747
Predicted Effect probably benign
Transcript: ENSMUST00000198311
SMART Domains Protein: ENSMUSP00000143233
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 9e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, globozoospermia, and defects in spermiogenesis and acrosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,657,649 (GRCm39) Y548F probably benign Het
Armc9 T C 1: 86,127,614 (GRCm39) L83P probably damaging Het
BC051665 A T 13: 60,932,344 (GRCm39) probably benign Het
Casp3 A G 8: 47,082,791 (GRCm39) N3S probably damaging Het
Ccdc174 G A 6: 91,865,070 (GRCm39) M109I probably benign Het
Ccr6 T A 17: 8,475,073 (GRCm39) F93I probably damaging Het
Clvs2 T C 10: 33,471,811 (GRCm39) S165G probably damaging Het
Cntnap5c T C 17: 58,320,941 (GRCm39) V171A probably benign Het
Dennd5a C A 7: 109,504,327 (GRCm39) probably null Het
Dock2 T A 11: 34,586,044 (GRCm39) Y546F probably benign Het
Fat2 A G 11: 55,158,401 (GRCm39) probably null Het
Focad T A 4: 88,197,481 (GRCm39) Y625N unknown Het
Fyb1 A G 15: 6,609,435 (GRCm39) K3E probably damaging Het
Gm14496 G A 2: 181,633,130 (GRCm39) D38N probably benign Het
Gm20403 T C 12: 55,033,155 (GRCm39) T54A probably benign Het
Gm9830 A G 9: 44,375,556 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,792,277 (GRCm39) S2487R probably damaging Het
Il5ra A G 6: 106,715,233 (GRCm39) L175S probably benign Het
Inhca A G 9: 103,136,566 (GRCm39) probably benign Het
Itgav C T 2: 83,633,599 (GRCm39) R983C probably damaging Het
Kcna10 T C 3: 107,102,032 (GRCm39) V221A probably damaging Het
Kif13b G A 14: 64,907,120 (GRCm39) V35I probably benign Het
Kif6 G A 17: 50,062,258 (GRCm39) E473K probably damaging Het
Mllt1 A G 17: 57,204,398 (GRCm39) S382P probably benign Het
Myo15b T C 11: 115,757,398 (GRCm39) W1083R probably damaging Het
Nell2 T C 15: 95,333,038 (GRCm39) I174V probably damaging Het
Noct G A 3: 51,157,117 (GRCm39) probably null Het
Nvl A T 1: 180,962,639 (GRCm39) probably benign Het
Ofcc1 T C 13: 40,250,595 (GRCm39) S574G probably benign Het
Or10a3m G A 7: 108,313,339 (GRCm39) V248I probably damaging Het
Or11h4 T C 14: 50,973,681 (GRCm39) M313V probably benign Het
Or4a75 A T 2: 89,447,924 (GRCm39) M204K possibly damaging Het
Pip5k1a A T 3: 94,972,807 (GRCm39) S415T probably damaging Het
Pkhd1 G A 1: 20,623,741 (GRCm39) P785S probably damaging Het
Plcg2 A G 8: 118,339,733 (GRCm39) Y1048C probably damaging Het
Ppp3cb A T 14: 20,570,720 (GRCm39) V337E probably benign Het
Prkg2 T C 5: 99,114,368 (GRCm39) probably benign Het
Prl7a2 T G 13: 27,843,089 (GRCm39) Y238S probably benign Het
Psg28 T A 7: 18,161,804 (GRCm39) D233V probably damaging Het
Rad50 A G 11: 53,589,036 (GRCm39) C221R probably benign Het
Rgl3 A G 9: 21,887,254 (GRCm39) probably benign Het
Rgsl1 T A 1: 153,701,014 (GRCm39) probably benign Het
Ror1 C A 4: 100,299,071 (GRCm39) R815S probably damaging Het
Rrp1b C A 17: 32,275,534 (GRCm39) D360E probably benign Het
Ryr3 T C 2: 112,496,680 (GRCm39) Q3682R possibly damaging Het
Sdr42e1 A T 8: 118,389,616 (GRCm39) F342I possibly damaging Het
Setd5 A G 6: 113,128,114 (GRCm39) R1337G probably benign Het
Siglecf T C 7: 43,001,140 (GRCm39) V36A probably damaging Het
Slc4a5 G A 6: 83,239,542 (GRCm39) G152D probably damaging Het
Sptbn4 T G 7: 27,063,587 (GRCm39) M2280L probably benign Het
Syngr2 T C 11: 117,703,406 (GRCm39) I74T probably damaging Het
Tm9sf1 T C 14: 55,878,866 (GRCm39) I175M possibly damaging Het
Tmc3 A G 7: 83,258,516 (GRCm39) E502G probably damaging Het
Tph1 T A 7: 46,311,463 (GRCm39) D88V possibly damaging Het
Tpr A G 1: 150,295,691 (GRCm39) K979E possibly damaging Het
Usp47 A G 7: 111,691,934 (GRCm39) T799A probably benign Het
Utf1 A G 7: 139,523,920 (GRCm39) E45G possibly damaging Het
Vmn1r208 A T 13: 22,956,772 (GRCm39) C242S probably damaging Het
Wrnip1 T C 13: 33,004,223 (GRCm39) I498T probably damaging Het
Ypel2 T A 11: 86,862,699 (GRCm39) H18L probably benign Het
Zan T G 5: 137,420,110 (GRCm39) D2849A unknown Het
Zfp647 A T 15: 76,795,860 (GRCm39) F267I probably damaging Het
Zfp786 G T 6: 47,797,905 (GRCm39) H344Q possibly damaging Het
Zswim3 G T 2: 164,662,614 (GRCm39) A365S probably benign Het
Zswim5 T C 4: 116,830,238 (GRCm39) W538R probably damaging Het
Other mutations in Mfsd14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Mfsd14a APN 3 116,435,504 (GRCm39) missense probably benign 0.16
IGL03197:Mfsd14a APN 3 116,430,012 (GRCm39) missense probably benign 0.01
R1166:Mfsd14a UTSW 3 116,427,543 (GRCm39) unclassified probably benign
R1796:Mfsd14a UTSW 3 116,428,596 (GRCm39) missense probably damaging 1.00
R1842:Mfsd14a UTSW 3 116,426,057 (GRCm39) missense possibly damaging 0.93
R1871:Mfsd14a UTSW 3 116,434,969 (GRCm39) missense probably benign 0.11
R2155:Mfsd14a UTSW 3 116,441,479 (GRCm39) missense probably damaging 1.00
R3078:Mfsd14a UTSW 3 116,441,566 (GRCm39) splice site probably benign
R4451:Mfsd14a UTSW 3 116,456,127 (GRCm39) start codon destroyed probably null 0.77
R4794:Mfsd14a UTSW 3 116,439,155 (GRCm39) intron probably benign
R5197:Mfsd14a UTSW 3 116,442,150 (GRCm39) intron probably benign
R5868:Mfsd14a UTSW 3 116,427,399 (GRCm39) missense probably benign
R7098:Mfsd14a UTSW 3 116,435,361 (GRCm39) missense probably benign 0.22
R7603:Mfsd14a UTSW 3 116,427,532 (GRCm39) missense probably damaging 0.97
R7836:Mfsd14a UTSW 3 116,442,200 (GRCm39) missense possibly damaging 0.95
R9229:Mfsd14a UTSW 3 116,439,118 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AAGACAGTCTTAAAGTACACTGCAG -3'
(R):5'- CAGACAGTTGCTGAGACATTGG -3'

Sequencing Primer
(F):5'- TGTACATCCAGAGCTACAGGTG -3'
(R):5'- GCTGAGACATTGGAGGCTG -3'
Posted On 2014-10-02