Incidental Mutation 'R2176:Slc4a5'
ID236870
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 5
SynonymsC330016K18Rik
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R2176 (G1)
Quality Score87
Status Validated
Chromosome6
Chromosomal Location83219828-83304945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83262560 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 152 (G152D)
Ref Sequence ENSEMBL: ENSMUSP00000109532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039212
AA Change: G152D

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: G152D

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113899
AA Change: G152D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: G152D

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113900
AA Change: G267D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: G267D

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122897
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83285899 missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83296597 missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83299471 missense probably benign
IGL01025:Slc4a5 APN 6 83262533 missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83273040 splice site probably null
IGL01991:Slc4a5 APN 6 83263543 missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83271103 splice site probably benign
IGL02565:Slc4a5 APN 6 83299505 missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83263543 missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83272124 missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83270997 missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83261525 missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83273157 missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83277555 missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83267567 splice site probably benign
R0366:Slc4a5 UTSW 6 83295872 missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83271072 missense probably damaging 1.00
R1222:Slc4a5 UTSW 6 83280132 missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83271057 missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83265687 missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83296635 missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83273232 missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83224681 missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2920:Slc4a5 UTSW 6 83264387 missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83260529 missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83270969 missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83272133 missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83271017 missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83285854 missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83261415 missense probably benign 0.11
R5747:Slc4a5 UTSW 6 83271029 missense probably damaging 1.00
R5978:Slc4a5 UTSW 6 83277536 missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83226265 missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83226374 missense probably benign
R6564:Slc4a5 UTSW 6 83280060 missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83296747 critical splice donor site probably null
R7443:Slc4a5 UTSW 6 83264315 missense probably benign 0.45
R7672:Slc4a5 UTSW 6 83260535 missense probably damaging 1.00
R7690:Slc4a5 UTSW 6 83285872 missense probably damaging 1.00
R7837:Slc4a5 UTSW 6 83261557 missense probably benign 0.01
R8169:Slc4a5 UTSW 6 83303391 missense probably benign 0.12
R8288:Slc4a5 UTSW 6 83226255 missense probably benign 0.01
R8397:Slc4a5 UTSW 6 83289326 critical splice donor site probably null
R8849:Slc4a5 UTSW 6 83273198 missense probably damaging 1.00
Z1177:Slc4a5 UTSW 6 83280033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTATTCTTGGAAGGGGAGATGTATC -3'
(R):5'- AGTGGTAAATCAGGCCCAGG -3'

Sequencing Primer
(F):5'- AAGGGGAGATGTATCTTGTCGTGAC -3'
(R):5'- CCAGGGGCAAGCCTAGGTTTAG -3'
Posted On2014-10-02