Mutagenetix > Incidental Mutation

Incidental Mutation 'R2176:Slc4a5'

236870

Institutional Source

Beutler Lab

Gene Symbol

Slc4a5

Ensembl Gene

ENSMUSG00000068323

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 5

Synonyms

C330016K18Rik

MMRRC Submission

040178-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R2176 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

83219828-83304945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83262560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 152 (G152D)

Ref Sequence

ENSEMBL: ENSMUSP00000109532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]

AlphaFold

E9Q3M5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039212
AA Change: G152D

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: G152D

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	5.2e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	1.1e-242	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113899
AA Change: G152D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: G152D

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	2.9e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	5.3e-243	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113900
AA Change: G267D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: G267D

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	140	407	3.4e-106	PFAM
low complexity region	436	465	N/A	INTRINSIC
Pfam:HCO3_cotransp	480	999	1.6e-224	PFAM
transmembrane domain	1006	1028	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122897

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,259,367		probably benign	Het
Adam1a	T	A	5: 121,519,586	Y548F	probably benign	Het
Armc9	T	C	1: 86,199,892	L83P	probably damaging	Het
BC051665	A	T	13: 60,784,530		probably benign	Het
Casp3	A	G	8: 46,629,756	N3S	probably damaging	Het
Ccdc174	G	A	6: 91,888,089	M109I	probably benign	Het
Ccr6	T	A	17: 8,256,241	F93I	probably damaging	Het
Clvs2	T	C	10: 33,595,815	S165G	probably damaging	Het
Cntnap5c	T	C	17: 58,013,946	V171A	probably benign	Het
Dennd5a	C	A	7: 109,905,120		probably null	Het
Dock2	T	A	11: 34,695,217	Y546F	probably benign	Het
Fat2	A	G	11: 55,267,575		probably null	Het
Focad	T	A	4: 88,279,244	Y625N	unknown	Het
Fyb	A	G	15: 6,579,954	K3E	probably damaging	Het
Gm14496	G	A	2: 181,991,337	D38N	probably benign	Het
Gm20403	T	C	12: 54,986,370	T54A	probably benign	Het
Gm9830	A	G	9: 44,464,259		noncoding transcript	Het
Hectd1	A	T	12: 51,745,494	S2487R	probably damaging	Het
Il5ra	A	G	6: 106,738,272	L175S	probably benign	Het
Itgav	C	T	2: 83,803,255	R983C	probably damaging	Het
Kcna10	T	C	3: 107,194,716	V221A	probably damaging	Het
Kif13b	G	A	14: 64,669,671	V35I	probably benign	Het
Kif6	G	A	17: 49,755,230	E473K	probably damaging	Het
Mfsd14a	T	C	3: 116,632,393	T452A	probably benign	Het
Mllt1	A	G	17: 56,897,398	S382P	probably benign	Het
Myo15b	T	C	11: 115,866,572	W1083R	probably damaging	Het
Nell2	T	C	15: 95,435,157	I174V	probably damaging	Het
Noct	G	A	3: 51,249,696		probably null	Het
Nvl	A	T	1: 181,135,074		probably benign	Het
Ofcc1	T	C	13: 40,097,119	S574G	probably benign	Het
Olfr1248	A	T	2: 89,617,580	M204K	possibly damaging	Het
Olfr512	G	A	7: 108,714,132	V248I	probably damaging	Het
Olfr749	T	C	14: 50,736,224	M313V	probably benign	Het
Pip5k1a	A	T	3: 95,065,496	S415T	probably damaging	Het
Pkhd1	G	A	1: 20,553,517	P785S	probably damaging	Het
Plcg2	A	G	8: 117,612,994	Y1048C	probably damaging	Het
Ppp3cb	A	T	14: 20,520,652	V337E	probably benign	Het
Prkg2	T	C	5: 98,966,509		probably benign	Het
Prl7a2	T	G	13: 27,659,106	Y238S	probably benign	Het
Psg28	T	A	7: 18,427,879	D233V	probably damaging	Het
Rad50	A	G	11: 53,698,209	C221R	probably benign	Het
Rgl3	A	G	9: 21,975,958		probably benign	Het
Rgsl1	T	A	1: 153,825,268		probably benign	Het
Ror1	C	A	4: 100,441,874	R815S	probably damaging	Het
Rrp1b	C	A	17: 32,056,560	D360E	probably benign	Het
Ryr3	T	C	2: 112,666,335	Q3682R	possibly damaging	Het
Sdr42e1	A	T	8: 117,662,877	F342I	possibly damaging	Het
Setd5	A	G	6: 113,151,153	R1337G	probably benign	Het
Siglecf	T	C	7: 43,351,716	V36A	probably damaging	Het
Sptbn4	T	G	7: 27,364,162	M2280L	probably benign	Het
Syngr2	T	C	11: 117,812,580	I74T	probably damaging	Het
Tm9sf1	T	C	14: 55,641,409	I175M	possibly damaging	Het
Tmc3	A	G	7: 83,609,308	E502G	probably damaging	Het
Tph1	T	A	7: 46,662,039	D88V	possibly damaging	Het
Tpr	A	G	1: 150,419,940	K979E	possibly damaging	Het
Usp47	A	G	7: 112,092,727	T799A	probably benign	Het
Utf1	A	G	7: 139,944,007	E45G	possibly damaging	Het
Vmn1r208	A	T	13: 22,772,602	C242S	probably damaging	Het
Wrnip1	T	C	13: 32,820,240	I498T	probably damaging	Het
Ypel2	T	A	11: 86,971,873	H18L	probably benign	Het
Zan	T	G	5: 137,421,848	D2849A	unknown	Het
Zfp647	A	T	15: 76,911,660	F267I	probably damaging	Het
Zfp786	G	T	6: 47,820,971	H344Q	possibly damaging	Het
Zswim3	G	T	2: 164,820,694	A365S	probably benign	Het
Zswim5	T	C	4: 116,973,041	W538R	probably damaging	Het

Other mutations in Slc4a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Slc4a5	APN	6	83285899	missense	probably damaging	1.00
IGL00473:Slc4a5	APN	6	83296597	missense	probably damaging	1.00
IGL00861:Slc4a5	APN	6	83299471	missense	probably benign
IGL01025:Slc4a5	APN	6	83262533	missense	probably damaging	0.98
IGL01532:Slc4a5	APN	6	83273040	splice site	probably null
IGL01991:Slc4a5	APN	6	83263543	missense	possibly damaging	0.94
IGL02271:Slc4a5	APN	6	83271103	splice site	probably benign
IGL02565:Slc4a5	APN	6	83299505	missense	probably benign	0.00
IGL02669:Slc4a5	APN	6	83263543	missense	possibly damaging	0.79
IGL02994:Slc4a5	APN	6	83272124	missense	probably damaging	1.00
IGL03259:Slc4a5	APN	6	83270997	missense	probably damaging	1.00
IGL03264:Slc4a5	APN	6	83261525	missense	probably damaging	1.00
R0032:Slc4a5	UTSW	6	83273157	missense	probably damaging	1.00
R0091:Slc4a5	UTSW	6	83277555	missense	probably benign	0.00
R0281:Slc4a5	UTSW	6	83267567	splice site	probably benign
R0366:Slc4a5	UTSW	6	83295872	missense	probably benign	0.02
R0668:Slc4a5	UTSW	6	83271072	missense	probably damaging	1.00
R1222:Slc4a5	UTSW	6	83280132	missense	probably damaging	1.00
R1550:Slc4a5	UTSW	6	83271057	missense	probably damaging	1.00
R1585:Slc4a5	UTSW	6	83265687	missense	probably damaging	1.00
R1731:Slc4a5	UTSW	6	83296635	missense	probably damaging	1.00
R1987:Slc4a5	UTSW	6	83273232	missense	possibly damaging	0.95
R2103:Slc4a5	UTSW	6	83224681	missense	probably benign	0.00
R2103:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2104:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2920:Slc4a5	UTSW	6	83264387	missense	probably damaging	1.00
R2964:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2965:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2966:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R3755:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R3756:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R4293:Slc4a5	UTSW	6	83260529	missense	probably damaging	1.00
R4789:Slc4a5	UTSW	6	83270969	missense	probably benign	0.05
R4823:Slc4a5	UTSW	6	83272133	missense	probably damaging	1.00
R4854:Slc4a5	UTSW	6	83271017	missense	probably benign	0.00
R5461:Slc4a5	UTSW	6	83285854	missense	probably benign	0.29
R5707:Slc4a5	UTSW	6	83261415	missense	probably benign	0.11
R5747:Slc4a5	UTSW	6	83271029	missense	probably damaging	1.00
R5978:Slc4a5	UTSW	6	83277536	missense	probably benign	0.01
R6126:Slc4a5	UTSW	6	83226265	missense	probably benign	0.05
R6330:Slc4a5	UTSW	6	83226374	missense	probably benign
R6564:Slc4a5	UTSW	6	83280060	missense	possibly damaging	0.71
R6786:Slc4a5	UTSW	6	83296747	critical splice donor site	probably null
R7443:Slc4a5	UTSW	6	83264315	missense	probably benign	0.45
R7672:Slc4a5	UTSW	6	83260535	missense	probably damaging	1.00
R7690:Slc4a5	UTSW	6	83285872	missense	probably damaging	1.00
R7837:Slc4a5	UTSW	6	83261557	missense	probably benign	0.01
R8169:Slc4a5	UTSW	6	83303391	missense	probably benign	0.12
R8288:Slc4a5	UTSW	6	83226255	missense	probably benign	0.01
R8397:Slc4a5	UTSW	6	83289326	critical splice donor site	probably null
R8849:Slc4a5	UTSW	6	83273198	missense	probably damaging	1.00
R9033:Slc4a5	UTSW	6	83260475	nonsense	probably null
R9133:Slc4a5	UTSW	6	83226235	missense	possibly damaging	0.85
R9201:Slc4a5	UTSW	6	83285830	missense	probably benign	0.02
R9269:Slc4a5	UTSW	6	83289241	missense	possibly damaging	0.88
R9603:Slc4a5	UTSW	6	83240732	missense	probably benign	0.34
R9781:Slc4a5	UTSW	6	83262484	missense	probably benign	0.00
Z1177:Slc4a5	UTSW	6	83280033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTATTCTTGGAAGGGGAGATGTATC -3'
(R):5'- AGTGGTAAATCAGGCCCAGG -3'

Sequencing Primer
(F):5'- AAGGGGAGATGTATCTTGTCGTGAC -3'
(R):5'- CCAGGGGCAAGCCTAGGTTTAG -3'

Posted On

2014-10-02