Mutagenetix > Incidental Mutation

Incidental Mutation 'R2176:Sptbn4'

236875

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

MMRRC Submission

040178-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R2176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 27364162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 2280 (M2280L)

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably benign
Transcript: ENSMUST00000011895
AA Change: M2285L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: M2285L

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108362
AA Change: M965L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: M965L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108363
AA Change: M965L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: M965L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108364
AA Change: M965L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: M965L

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172269
AA Change: M2280L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: M2280L

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,259,367		probably benign	Het
Adam1a	T	A	5: 121,519,586	Y548F	probably benign	Het
Armc9	T	C	1: 86,199,892	L83P	probably damaging	Het
BC051665	A	T	13: 60,784,530		probably benign	Het
Casp3	A	G	8: 46,629,756	N3S	probably damaging	Het
Ccdc174	G	A	6: 91,888,089	M109I	probably benign	Het
Ccr6	T	A	17: 8,256,241	F93I	probably damaging	Het
Clvs2	T	C	10: 33,595,815	S165G	probably damaging	Het
Cntnap5c	T	C	17: 58,013,946	V171A	probably benign	Het
Dennd5a	C	A	7: 109,905,120		probably null	Het
Dock2	T	A	11: 34,695,217	Y546F	probably benign	Het
Fat2	A	G	11: 55,267,575		probably null	Het
Focad	T	A	4: 88,279,244	Y625N	unknown	Het
Fyb	A	G	15: 6,579,954	K3E	probably damaging	Het
Gm14496	G	A	2: 181,991,337	D38N	probably benign	Het
Gm20403	T	C	12: 54,986,370	T54A	probably benign	Het
Gm9830	A	G	9: 44,464,259		noncoding transcript	Het
Hectd1	A	T	12: 51,745,494	S2487R	probably damaging	Het
Il5ra	A	G	6: 106,738,272	L175S	probably benign	Het
Itgav	C	T	2: 83,803,255	R983C	probably damaging	Het
Kcna10	T	C	3: 107,194,716	V221A	probably damaging	Het
Kif13b	G	A	14: 64,669,671	V35I	probably benign	Het
Kif6	G	A	17: 49,755,230	E473K	probably damaging	Het
Mfsd14a	T	C	3: 116,632,393	T452A	probably benign	Het
Mllt1	A	G	17: 56,897,398	S382P	probably benign	Het
Myo15b	T	C	11: 115,866,572	W1083R	probably damaging	Het
Nell2	T	C	15: 95,435,157	I174V	probably damaging	Het
Noct	G	A	3: 51,249,696		probably null	Het
Nvl	A	T	1: 181,135,074		probably benign	Het
Ofcc1	T	C	13: 40,097,119	S574G	probably benign	Het
Olfr1248	A	T	2: 89,617,580	M204K	possibly damaging	Het
Olfr512	G	A	7: 108,714,132	V248I	probably damaging	Het
Olfr749	T	C	14: 50,736,224	M313V	probably benign	Het
Pip5k1a	A	T	3: 95,065,496	S415T	probably damaging	Het
Pkhd1	G	A	1: 20,553,517	P785S	probably damaging	Het
Plcg2	A	G	8: 117,612,994	Y1048C	probably damaging	Het
Ppp3cb	A	T	14: 20,520,652	V337E	probably benign	Het
Prkg2	T	C	5: 98,966,509		probably benign	Het
Prl7a2	T	G	13: 27,659,106	Y238S	probably benign	Het
Psg28	T	A	7: 18,427,879	D233V	probably damaging	Het
Rad50	A	G	11: 53,698,209	C221R	probably benign	Het
Rgl3	A	G	9: 21,975,958		probably benign	Het
Rgsl1	T	A	1: 153,825,268		probably benign	Het
Ror1	C	A	4: 100,441,874	R815S	probably damaging	Het
Rrp1b	C	A	17: 32,056,560	D360E	probably benign	Het
Ryr3	T	C	2: 112,666,335	Q3682R	possibly damaging	Het
Sdr42e1	A	T	8: 117,662,877	F342I	possibly damaging	Het
Setd5	A	G	6: 113,151,153	R1337G	probably benign	Het
Siglecf	T	C	7: 43,351,716	V36A	probably damaging	Het
Slc4a5	G	A	6: 83,262,560	G152D	probably damaging	Het
Syngr2	T	C	11: 117,812,580	I74T	probably damaging	Het
Tm9sf1	T	C	14: 55,641,409	I175M	possibly damaging	Het
Tmc3	A	G	7: 83,609,308	E502G	probably damaging	Het
Tph1	T	A	7: 46,662,039	D88V	possibly damaging	Het
Tpr	A	G	1: 150,419,940	K979E	possibly damaging	Het
Usp47	A	G	7: 112,092,727	T799A	probably benign	Het
Utf1	A	G	7: 139,944,007	E45G	possibly damaging	Het
Vmn1r208	A	T	13: 22,772,602	C242S	probably damaging	Het
Wrnip1	T	C	13: 32,820,240	I498T	probably damaging	Het
Ypel2	T	A	11: 86,971,873	H18L	probably benign	Het
Zan	T	G	5: 137,421,848	D2849A	unknown	Het
Zfp647	A	T	15: 76,911,660	F267I	probably damaging	Het
Zfp786	G	T	6: 47,820,971	H344Q	possibly damaging	Het
Zswim3	G	T	2: 164,820,694	A365S	probably benign	Het
Zswim5	T	C	4: 116,973,041	W538R	probably damaging	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0510:Sptbn4	UTSW	7	27361566	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27366646	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4684:Sptbn4	UTSW	7	27366735	missense	possibly damaging	0.60
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27416785	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ATAAGGCTGTTTCCCTCGC -3'
(R):5'- ACTGGGGCGCAAGTTCTTTG -3'

Sequencing Primer
(F):5'- GTTTCCCTCGCTGACCCTGG -3'
(R):5'- TATGTGCGCCAGGAGCTCAAG -3'

Posted On

2014-10-02