Incidental Mutation 'R2176:Siglecf'
ID236876
Institutional Source Beutler Lab
Gene Symbol Siglecf
Ensembl Gene ENSMUSG00000039013
Gene Namesialic acid binding Ig-like lectin F
SynonymsmSiglec-F, Siglec5
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43351341-43359531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43351716 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000112583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012798
AA Change: V36A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: V36A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121494
AA Change: V36A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: V36A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122423
AA Change: V36A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: V36A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145867
Predicted Effect possibly damaging
Transcript: ENSMUST00000206299
AA Change: V36A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Siglecf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Siglecf APN 7 43351953 nonsense probably null
IGL01350:Siglecf APN 7 43355895 intron probably benign
IGL01458:Siglecf APN 7 43355138 missense possibly damaging 0.46
IGL01582:Siglecf APN 7 43358721 missense possibly damaging 0.55
IGL02347:Siglecf APN 7 43351721 missense possibly damaging 0.78
IGL02530:Siglecf APN 7 43352210 missense probably benign 0.07
IGL02700:Siglecf APN 7 43352378 missense probably damaging 1.00
IGL03093:Siglecf APN 7 43352441 missense probably damaging 1.00
IGL03178:Siglecf APN 7 43358739 missense probably damaging 0.98
IGL03280:Siglecf APN 7 43355930 missense probably benign 0.04
ANU23:Siglecf UTSW 7 43351953 nonsense probably null
R0003:Siglecf UTSW 7 43355926 missense probably benign
R0025:Siglecf UTSW 7 43351925 missense probably benign 0.29
R0304:Siglecf UTSW 7 43352401 missense probably damaging 1.00
R0345:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R0395:Siglecf UTSW 7 43355975 missense probably damaging 1.00
R0515:Siglecf UTSW 7 43355631 critical splice donor site probably null
R1296:Siglecf UTSW 7 43355920 nonsense probably null
R1861:Siglecf UTSW 7 43352224 missense probably benign 0.00
R1861:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1869:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1870:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1871:Siglecf UTSW 7 43355543 missense probably benign 0.01
R2063:Siglecf UTSW 7 43352380 missense possibly damaging 0.79
R2237:Siglecf UTSW 7 43354985 missense probably benign 0.06
R4023:Siglecf UTSW 7 43355571 missense possibly damaging 0.56
R4498:Siglecf UTSW 7 43352276 missense possibly damaging 0.47
R4664:Siglecf UTSW 7 43356413 missense possibly damaging 0.75
R5227:Siglecf UTSW 7 43351940 missense probably damaging 1.00
R5315:Siglecf UTSW 7 43355108 missense probably benign 0.01
R5763:Siglecf UTSW 7 43356320 nonsense probably null
R5828:Siglecf UTSW 7 43351713 missense probably damaging 1.00
R5871:Siglecf UTSW 7 43355621 missense probably benign 0.04
R5952:Siglecf UTSW 7 43355927 missense probably benign 0.00
R6054:Siglecf UTSW 7 43355006 missense probably damaging 1.00
R6537:Siglecf UTSW 7 43355999 missense probably benign
R6854:Siglecf UTSW 7 43352180 missense probably benign 0.00
R6875:Siglecf UTSW 7 43355200 missense probably benign 0.04
R7328:Siglecf UTSW 7 43352267 missense possibly damaging 0.92
R7329:Siglecf UTSW 7 43351971 missense probably damaging 1.00
R7356:Siglecf UTSW 7 43356431 missense probably benign 0.00
R7369:Siglecf UTSW 7 43351817 missense probably damaging 0.99
R7659:Siglecf UTSW 7 43351770 missense probably damaging 1.00
R7984:Siglecf UTSW 7 43355231 splice site probably null
R8074:Siglecf UTSW 7 43351790 missense possibly damaging 0.93
R8411:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R8686:Siglecf UTSW 7 43355606 missense probably benign 0.31
R8724:Siglecf UTSW 7 43355552 missense probably damaging 1.00
R8962:Siglecf UTSW 7 43351716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAACCTAGAGCCTTTCAC -3'
(R):5'- TGTGCATCTCTGATGTCCAGG -3'

Sequencing Primer
(F):5'- AACCTAGAGCCTTTCACTGTGTGATG -3'
(R):5'- TCTGATGTCCAGGGAGCAATTATGAC -3'
Posted On2014-10-02