Incidental Mutation 'R0201:Lgi1'
ID23688
Institutional Source Beutler Lab
Gene Symbol Lgi1
Ensembl Gene ENSMUSG00000067242
Gene Nameleucine-rich repeat LGI family, member 1
Synonyms
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38264536-38312214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38301293 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 269 (E269G)
Ref Sequence ENSEMBL: ENSMUSP00000143128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087252] [ENSMUST00000196090] [ENSMUST00000197123] [ENSMUST00000198045] [ENSMUST00000198518] [ENSMUST00000199812]
Predicted Effect probably benign
Transcript: ENSMUST00000087252
SMART Domains Protein: ENSMUSP00000084507
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 225 266 3.8e-9 PFAM
Pfam:EPTP 271 312 6.5e-12 PFAM
Pfam:EPTP 317 363 7.2e-16 PFAM
Pfam:EPTP 366 414 1.4e-7 PFAM
Pfam:EPTP 419 461 1.6e-12 PFAM
Pfam:EPTP 464 505 7.7e-11 PFAM
Pfam:EPTP 510 550 3.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130039
SMART Domains Protein: ENSMUSP00000117936
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
LRR 51 74 2.61e2 SMART
LRR_TYP 75 98 5.14e-3 SMART
LRR_TYP 99 122 2.27e-4 SMART
LRRCT 131 180 4.63e-6 SMART
Pfam:EPTP 182 218 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196090
AA Change: E221G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143538
Gene: ENSMUSG00000067242
AA Change: E221G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 3.3e-4 SMART
LRRCT 125 174 2.3e-8 SMART
Pfam:EPTP 177 218 3.1e-6 PFAM
Pfam:EPTP 223 264 5.3e-9 PFAM
Pfam:EPTP 269 315 5.8e-13 PFAM
Pfam:EPTP 318 366 1.1e-4 PFAM
Pfam:EPTP 371 413 1.3e-9 PFAM
Pfam:EPTP 416 457 6.2e-8 PFAM
Pfam:EPTP 462 502 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197123
SMART Domains Protein: ENSMUSP00000142953
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198045
AA Change: E269G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143292
Gene: ENSMUSG00000067242
AA Change: E269G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
LRR 90 113 1.1e0 SMART
LRR_TYP 114 137 2.1e-5 SMART
LRR_TYP 138 161 9.2e-7 SMART
LRRCT 173 222 2.3e-8 SMART
Pfam:EPTP 224 267 2.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198518
AA Change: E269G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143128
Gene: ENSMUSG00000067242
AA Change: E269G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 224 267 8.3e-15 PFAM
Pfam:EPTP 270 313 9.4e-16 PFAM
Pfam:EPTP 316 364 3.3e-18 PFAM
Pfam:EPTP 365 415 5.2e-8 PFAM
Pfam:EPTP 418 462 1e-16 PFAM
Pfam:EPTP 463 506 1.9e-15 PFAM
Pfam:EPTP 509 550 2.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199812
AA Change: E245G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143502
Gene: ENSMUSG00000067242
AA Change: E245G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 2.2e-5 SMART
LRR_TYP 114 137 9.4e-7 SMART
LRRCT 149 198 2.3e-8 SMART
Pfam:EPTP 201 242 3.2e-6 PFAM
Pfam:EPTP 247 288 5.6e-9 PFAM
Pfam:EPTP 293 339 6.1e-13 PFAM
Pfam:EPTP 342 390 1.2e-4 PFAM
Pfam:EPTP 395 437 1.4e-9 PFAM
Pfam:EPTP 440 481 6.6e-8 PFAM
Pfam:EPTP 486 526 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200561
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the secreted leucine-rich repeat (LRR) superfamily and shares homology with members of the SLIT protein family. The encoded protein may regulate the activity of voltage-gated potassium channels and may be involved in neuronal growth regulation and cell survival. This gene is rearranged as a result of translocations in glioblastoma cell lines, and it is frequently down-regulated or rearranged in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, seizures, and death by the third week of life. Mice heterozygous for this allele exhibit increased suseptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Lgi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Lgi1 APN 19 38284005 missense probably benign 0.24
IGL03112:Lgi1 APN 19 38284030 missense possibly damaging 0.84
R1573:Lgi1 UTSW 19 38284181 missense probably benign 0.30
R1795:Lgi1 UTSW 19 38306183 missense probably benign
R2010:Lgi1 UTSW 19 38301235 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3733:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R4643:Lgi1 UTSW 19 38300710 missense probably damaging 1.00
R4678:Lgi1 UTSW 19 38301289 missense probably damaging 1.00
R4814:Lgi1 UTSW 19 38300878 critical splice donor site probably null
R4857:Lgi1 UTSW 19 38306250 missense probably damaging 1.00
R5598:Lgi1 UTSW 19 38306181 missense possibly damaging 0.94
R6180:Lgi1 UTSW 19 38264956 missense probably damaging 1.00
R6196:Lgi1 UTSW 19 38305809 missense probably benign 0.23
R6847:Lgi1 UTSW 19 38301290 missense probably damaging 1.00
R7178:Lgi1 UTSW 19 38306285 missense probably damaging 1.00
R7376:Lgi1 UTSW 19 38284020 missense probably damaging 1.00
R7448:Lgi1 UTSW 19 38301265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGAAGGCCCACCGGAATATAAG -3'
(R):5'- GGGGTTAACACAACTAAGACCAGTCAG -3'

Sequencing Primer
(F):5'- TATTTGGGATCTAGCCAAGAAGTGC -3'
(R):5'- CCCTTGGGCAAAGCAGTTTA -3'
Posted On2013-04-16