Incidental Mutation 'R2176:Usp47'
ID 236880
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Name ubiquitin specific peptidase 47
Synonyms A630020C16Rik, 4930502N04Rik
MMRRC Submission 040178-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R2176 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 111622692-111710591 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111691934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 799 (T799A)
Ref Sequence ENSEMBL: ENSMUSP00000151051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
AlphaFold Q8BY87
Predicted Effect probably benign
Transcript: ENSMUST00000106653
AA Change: T779A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: T779A

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210309
AA Change: T799A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210526
Predicted Effect probably benign
Transcript: ENSMUST00000215510
AA Change: T799A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,657,649 (GRCm39) Y548F probably benign Het
Armc9 T C 1: 86,127,614 (GRCm39) L83P probably damaging Het
BC051665 A T 13: 60,932,344 (GRCm39) probably benign Het
Casp3 A G 8: 47,082,791 (GRCm39) N3S probably damaging Het
Ccdc174 G A 6: 91,865,070 (GRCm39) M109I probably benign Het
Ccr6 T A 17: 8,475,073 (GRCm39) F93I probably damaging Het
Clvs2 T C 10: 33,471,811 (GRCm39) S165G probably damaging Het
Cntnap5c T C 17: 58,320,941 (GRCm39) V171A probably benign Het
Dennd5a C A 7: 109,504,327 (GRCm39) probably null Het
Dock2 T A 11: 34,586,044 (GRCm39) Y546F probably benign Het
Fat2 A G 11: 55,158,401 (GRCm39) probably null Het
Focad T A 4: 88,197,481 (GRCm39) Y625N unknown Het
Fyb1 A G 15: 6,609,435 (GRCm39) K3E probably damaging Het
Gm14496 G A 2: 181,633,130 (GRCm39) D38N probably benign Het
Gm20403 T C 12: 55,033,155 (GRCm39) T54A probably benign Het
Gm9830 A G 9: 44,375,556 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,792,277 (GRCm39) S2487R probably damaging Het
Il5ra A G 6: 106,715,233 (GRCm39) L175S probably benign Het
Inhca A G 9: 103,136,566 (GRCm39) probably benign Het
Itgav C T 2: 83,633,599 (GRCm39) R983C probably damaging Het
Kcna10 T C 3: 107,102,032 (GRCm39) V221A probably damaging Het
Kif13b G A 14: 64,907,120 (GRCm39) V35I probably benign Het
Kif6 G A 17: 50,062,258 (GRCm39) E473K probably damaging Het
Mfsd14a T C 3: 116,426,042 (GRCm39) T452A probably benign Het
Mllt1 A G 17: 57,204,398 (GRCm39) S382P probably benign Het
Myo15b T C 11: 115,757,398 (GRCm39) W1083R probably damaging Het
Nell2 T C 15: 95,333,038 (GRCm39) I174V probably damaging Het
Noct G A 3: 51,157,117 (GRCm39) probably null Het
Nvl A T 1: 180,962,639 (GRCm39) probably benign Het
Ofcc1 T C 13: 40,250,595 (GRCm39) S574G probably benign Het
Or10a3m G A 7: 108,313,339 (GRCm39) V248I probably damaging Het
Or11h4 T C 14: 50,973,681 (GRCm39) M313V probably benign Het
Or4a75 A T 2: 89,447,924 (GRCm39) M204K possibly damaging Het
Pip5k1a A T 3: 94,972,807 (GRCm39) S415T probably damaging Het
Pkhd1 G A 1: 20,623,741 (GRCm39) P785S probably damaging Het
Plcg2 A G 8: 118,339,733 (GRCm39) Y1048C probably damaging Het
Ppp3cb A T 14: 20,570,720 (GRCm39) V337E probably benign Het
Prkg2 T C 5: 99,114,368 (GRCm39) probably benign Het
Prl7a2 T G 13: 27,843,089 (GRCm39) Y238S probably benign Het
Psg28 T A 7: 18,161,804 (GRCm39) D233V probably damaging Het
Rad50 A G 11: 53,589,036 (GRCm39) C221R probably benign Het
Rgl3 A G 9: 21,887,254 (GRCm39) probably benign Het
Rgsl1 T A 1: 153,701,014 (GRCm39) probably benign Het
Ror1 C A 4: 100,299,071 (GRCm39) R815S probably damaging Het
Rrp1b C A 17: 32,275,534 (GRCm39) D360E probably benign Het
Ryr3 T C 2: 112,496,680 (GRCm39) Q3682R possibly damaging Het
Sdr42e1 A T 8: 118,389,616 (GRCm39) F342I possibly damaging Het
Setd5 A G 6: 113,128,114 (GRCm39) R1337G probably benign Het
Siglecf T C 7: 43,001,140 (GRCm39) V36A probably damaging Het
Slc4a5 G A 6: 83,239,542 (GRCm39) G152D probably damaging Het
Sptbn4 T G 7: 27,063,587 (GRCm39) M2280L probably benign Het
Syngr2 T C 11: 117,703,406 (GRCm39) I74T probably damaging Het
Tm9sf1 T C 14: 55,878,866 (GRCm39) I175M possibly damaging Het
Tmc3 A G 7: 83,258,516 (GRCm39) E502G probably damaging Het
Tph1 T A 7: 46,311,463 (GRCm39) D88V possibly damaging Het
Tpr A G 1: 150,295,691 (GRCm39) K979E possibly damaging Het
Utf1 A G 7: 139,523,920 (GRCm39) E45G possibly damaging Het
Vmn1r208 A T 13: 22,956,772 (GRCm39) C242S probably damaging Het
Wrnip1 T C 13: 33,004,223 (GRCm39) I498T probably damaging Het
Ypel2 T A 11: 86,862,699 (GRCm39) H18L probably benign Het
Zan T G 5: 137,420,110 (GRCm39) D2849A unknown Het
Zfp647 A T 15: 76,795,860 (GRCm39) F267I probably damaging Het
Zfp786 G T 6: 47,797,905 (GRCm39) H344Q possibly damaging Het
Zswim3 G T 2: 164,662,614 (GRCm39) A365S probably benign Het
Zswim5 T C 4: 116,830,238 (GRCm39) W538R probably damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 111,673,990 (GRCm39) missense probably benign 0.00
IGL00574:Usp47 APN 7 111,662,542 (GRCm39) missense probably damaging 1.00
IGL00975:Usp47 APN 7 111,692,577 (GRCm39) missense probably damaging 1.00
IGL01289:Usp47 APN 7 111,662,565 (GRCm39) missense probably damaging 1.00
IGL01419:Usp47 APN 7 111,687,118 (GRCm39) missense possibly damaging 0.94
IGL01645:Usp47 APN 7 111,654,069 (GRCm39) missense probably damaging 0.96
IGL01871:Usp47 APN 7 111,676,993 (GRCm39) splice site probably benign
IGL02066:Usp47 APN 7 111,663,604 (GRCm39) missense probably damaging 1.00
IGL02122:Usp47 APN 7 111,706,115 (GRCm39) missense probably damaging 0.97
IGL02153:Usp47 APN 7 111,703,256 (GRCm39) missense probably benign 0.00
IGL02550:Usp47 APN 7 111,703,561 (GRCm39) missense probably damaging 1.00
IGL02710:Usp47 APN 7 111,692,132 (GRCm39) missense probably benign 0.01
IGL02756:Usp47 APN 7 111,692,270 (GRCm39) missense possibly damaging 0.76
IGL03093:Usp47 APN 7 111,688,827 (GRCm39) missense probably damaging 1.00
IGL03398:Usp47 APN 7 111,673,710 (GRCm39) missense probably damaging 1.00
0152:Usp47 UTSW 7 111,655,784 (GRCm39) missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 111,703,548 (GRCm39) splice site probably benign
R0110:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0381:Usp47 UTSW 7 111,662,600 (GRCm39) critical splice donor site probably null
R0450:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0634:Usp47 UTSW 7 111,707,862 (GRCm39) missense probably damaging 1.00
R0881:Usp47 UTSW 7 111,690,643 (GRCm39) missense possibly damaging 0.51
R1178:Usp47 UTSW 7 111,709,205 (GRCm39) missense possibly damaging 0.68
R1447:Usp47 UTSW 7 111,673,775 (GRCm39) critical splice donor site probably null
R1640:Usp47 UTSW 7 111,682,334 (GRCm39) missense probably damaging 0.99
R1727:Usp47 UTSW 7 111,685,307 (GRCm39) missense probably damaging 0.96
R1866:Usp47 UTSW 7 111,701,077 (GRCm39) missense possibly damaging 0.93
R1876:Usp47 UTSW 7 111,654,127 (GRCm39) missense probably damaging 0.99
R1953:Usp47 UTSW 7 111,692,083 (GRCm39) missense probably benign 0.26
R2117:Usp47 UTSW 7 111,666,443 (GRCm39) critical splice donor site probably null
R2187:Usp47 UTSW 7 111,666,398 (GRCm39) missense probably damaging 1.00
R2504:Usp47 UTSW 7 111,703,677 (GRCm39) critical splice donor site probably null
R2902:Usp47 UTSW 7 111,692,658 (GRCm39) missense probably damaging 1.00
R2922:Usp47 UTSW 7 111,692,405 (GRCm39) missense probably damaging 1.00
R2939:Usp47 UTSW 7 111,681,743 (GRCm39) missense probably damaging 1.00
R4065:Usp47 UTSW 7 111,652,623 (GRCm39) missense probably benign 0.30
R4179:Usp47 UTSW 7 111,687,091 (GRCm39) missense probably damaging 1.00
R4235:Usp47 UTSW 7 111,709,255 (GRCm39) missense probably damaging 0.99
R4243:Usp47 UTSW 7 111,707,836 (GRCm39) missense probably damaging 1.00
R4281:Usp47 UTSW 7 111,709,200 (GRCm39) missense probably benign 0.03
R4360:Usp47 UTSW 7 111,654,139 (GRCm39) missense probably damaging 1.00
R4604:Usp47 UTSW 7 111,701,038 (GRCm39) missense probably damaging 1.00
R4857:Usp47 UTSW 7 111,681,759 (GRCm39) missense probably damaging 1.00
R5133:Usp47 UTSW 7 111,683,089 (GRCm39) missense probably damaging 1.00
R5179:Usp47 UTSW 7 111,692,639 (GRCm39) missense probably damaging 1.00
R5322:Usp47 UTSW 7 111,652,476 (GRCm39) missense probably damaging 0.99
R5445:Usp47 UTSW 7 111,673,928 (GRCm39) missense probably damaging 1.00
R5465:Usp47 UTSW 7 111,658,209 (GRCm39) missense probably damaging 1.00
R5699:Usp47 UTSW 7 111,709,204 (GRCm39) missense probably benign 0.00
R5961:Usp47 UTSW 7 111,652,523 (GRCm39) missense probably damaging 1.00
R6117:Usp47 UTSW 7 111,687,139 (GRCm39) missense probably damaging 0.98
R6271:Usp47 UTSW 7 111,686,263 (GRCm39) missense probably damaging 1.00
R7155:Usp47 UTSW 7 111,686,220 (GRCm39) missense probably damaging 0.97
R7229:Usp47 UTSW 7 111,692,084 (GRCm39) missense probably benign 0.04
R7246:Usp47 UTSW 7 111,715,116 (GRCm39)
R7285:Usp47 UTSW 7 111,692,315 (GRCm39) missense probably benign 0.02
R7938:Usp47 UTSW 7 111,687,132 (GRCm39) missense probably damaging 0.99
R8079:Usp47 UTSW 7 111,646,177 (GRCm39) missense probably damaging 1.00
R8114:Usp47 UTSW 7 111,692,394 (GRCm39) missense probably damaging 1.00
R8141:Usp47 UTSW 7 111,652,472 (GRCm39) missense possibly damaging 0.60
R8172:Usp47 UTSW 7 111,687,133 (GRCm39) nonsense probably null
R8223:Usp47 UTSW 7 111,703,583 (GRCm39) missense probably damaging 1.00
R8510:Usp47 UTSW 7 111,658,208 (GRCm39) missense probably damaging 1.00
R8701:Usp47 UTSW 7 111,692,402 (GRCm39) missense probably damaging 1.00
R9106:Usp47 UTSW 7 111,681,713 (GRCm39) missense probably damaging 1.00
R9135:Usp47 UTSW 7 111,652,431 (GRCm39) missense probably benign 0.30
R9311:Usp47 UTSW 7 111,703,257 (GRCm39) missense probably benign 0.02
R9417:Usp47 UTSW 7 111,688,801 (GRCm39) missense possibly damaging 0.86
R9487:Usp47 UTSW 7 111,677,063 (GRCm39) missense probably damaging 0.99
R9628:Usp47 UTSW 7 111,705,999 (GRCm39) missense probably benign 0.01
RF010:Usp47 UTSW 7 111,692,145 (GRCm39) missense probably damaging 0.99
X0027:Usp47 UTSW 7 111,687,054 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCCAGAATGCTCCTTTC -3'
(R):5'- AAATTCCCTGCAGGTCCTTTGAC -3'

Sequencing Primer
(F):5'- AGGCTAGCCTGTGACAATTGTCC -3'
(R):5'- GCAGGTCCTTTGACTCTTTCACAATC -3'
Posted On 2014-10-02