Incidental Mutation 'R0173:Rab3gap2'
ID23690
Institutional Source Beutler Lab
Gene Symbol Rab3gap2
Ensembl Gene ENSMUSG00000039318
Gene NameRAB3 GTPase activating protein subunit 2
Synonyms1110059F07Rik
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0173 (G1)
Quality Score196
Status Validated (trace)
Chromosome1
Chromosomal Location185204117-185286759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 185249907 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 385 (H385Q)
Ref Sequence ENSEMBL: ENSMUSP00000141608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect probably benign
Transcript: ENSMUST00000069652
AA Change: H385Q

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: H385Q

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193245
Predicted Effect possibly damaging
Transcript: ENSMUST00000194740
AA Change: H385Q

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: H385Q

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Rab3gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Rab3gap2 APN 1 185238870 missense probably damaging 1.00
IGL01620:Rab3gap2 APN 1 185204326 missense probably benign
IGL01977:Rab3gap2 APN 1 185267023 nonsense probably null
IGL02183:Rab3gap2 APN 1 185271468 nonsense probably null
IGL02229:Rab3gap2 APN 1 185259383 missense possibly damaging 0.71
IGL02231:Rab3gap2 APN 1 185266898 splice site probably benign
IGL02506:Rab3gap2 APN 1 185252024 splice site probably benign
IGL02618:Rab3gap2 APN 1 185251741 missense possibly damaging 0.79
IGL02643:Rab3gap2 APN 1 185267000 missense possibly damaging 0.69
IGL03239:Rab3gap2 APN 1 185249894 missense probably damaging 1.00
PIT4498001:Rab3gap2 UTSW 1 185281685 missense probably damaging 1.00
R0372:Rab3gap2 UTSW 1 185262694 missense possibly damaging 0.93
R0492:Rab3gap2 UTSW 1 185252392 splice site probably benign
R0510:Rab3gap2 UTSW 1 185260508 splice site probably benign
R0708:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R0711:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R1135:Rab3gap2 UTSW 1 185275943 missense possibly damaging 0.95
R1428:Rab3gap2 UTSW 1 185247904 missense probably damaging 1.00
R1599:Rab3gap2 UTSW 1 185251026 missense probably benign 0.07
R1758:Rab3gap2 UTSW 1 185283884 missense probably benign 0.13
R1903:Rab3gap2 UTSW 1 185221902 missense probably benign
R1929:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R1994:Rab3gap2 UTSW 1 185236024 missense probably damaging 1.00
R2010:Rab3gap2 UTSW 1 185278281 missense possibly damaging 0.57
R2102:Rab3gap2 UTSW 1 185282389 missense probably benign 0.00
R2120:Rab3gap2 UTSW 1 185261367 missense possibly damaging 0.95
R2219:Rab3gap2 UTSW 1 185275916 missense probably damaging 0.99
R2259:Rab3gap2 UTSW 1 185221859 missense probably damaging 1.00
R2270:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R2272:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R3083:Rab3gap2 UTSW 1 185204269 missense probably benign 0.00
R3776:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R4050:Rab3gap2 UTSW 1 185272643 critical splice donor site probably null
R4130:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R4176:Rab3gap2 UTSW 1 185246666 missense probably damaging 0.99
R4296:Rab3gap2 UTSW 1 185255837 critical splice donor site probably null
R4416:Rab3gap2 UTSW 1 185282347 missense probably benign 0.00
R4426:Rab3gap2 UTSW 1 185235342 missense probably damaging 1.00
R4516:Rab3gap2 UTSW 1 185267068 missense probably benign
R4518:Rab3gap2 UTSW 1 185267068 missense probably benign
R4891:Rab3gap2 UTSW 1 185259366 missense probably benign 0.00
R4913:Rab3gap2 UTSW 1 185262829 missense probably benign 0.12
R4955:Rab3gap2 UTSW 1 185267155 intron probably benign
R5411:Rab3gap2 UTSW 1 185277145 critical splice acceptor site probably null
R5516:Rab3gap2 UTSW 1 185235487 missense probably benign 0.02
R5670:Rab3gap2 UTSW 1 185221899 missense probably benign
R5670:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R6380:Rab3gap2 UTSW 1 185235984 missense probably damaging 1.00
R6533:Rab3gap2 UTSW 1 185232954 splice site probably null
R6655:Rab3gap2 UTSW 1 185250011 missense probably damaging 1.00
R6676:Rab3gap2 UTSW 1 185283410 missense probably damaging 1.00
R6726:Rab3gap2 UTSW 1 185247865 missense probably damaging 0.99
R6969:Rab3gap2 UTSW 1 185236012 missense probably damaging 1.00
R7151:Rab3gap2 UTSW 1 185248053 missense probably benign 0.00
R7168:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R7196:Rab3gap2 UTSW 1 185281667 missense probably damaging 1.00
R7201:Rab3gap2 UTSW 1 185267191 missense probably damaging 1.00
R7371:Rab3gap2 UTSW 1 185251068 missense probably damaging 1.00
R7573:Rab3gap2 UTSW 1 185282382 missense probably benign
R7779:Rab3gap2 UTSW 1 185259444 missense probably damaging 0.98
R7913:Rab3gap2 UTSW 1 185262816 missense possibly damaging 0.88
R7994:Rab3gap2 UTSW 1 185262816 missense possibly damaging 0.88
Z1088:Rab3gap2 UTSW 1 185281677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCCAGACATGAGAGTGAACCC -3'
(R):5'- TGTGACCAACCAGACGCTGAAG -3'

Sequencing Primer
(F):5'- ATGGTGTCTCCTGACACAAG -3'
(R):5'- GCTGAAGGATAAAGTTGCTCACTAC -3'
Posted On2013-04-16