Mutagenetix > Incidental Mutation

Incidental Mutation 'R2176:Cntnap5c'

236912

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5c

Ensembl Gene

ENSMUSG00000038048

Gene Name

contactin associated protein-like 5C

Synonyms

MMRRC Submission

040178-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R2176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57769570-58410355 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58013946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 171 (V171A)

Ref Sequence

ENSEMBL: ENSMUSP00000075416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076038]

AlphaFold

Q0V8T7

Predicted Effect

probably benign
Transcript: ENSMUST00000076038
AA Change: V171A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: V171A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	29	174	1.26e-10	SMART
LamG	201	338	1.57e-29	SMART
LamG	387	521	3e-26	SMART
EGF	549	583	1.88e-1	SMART
Blast:FBG	586	769	8e-83	BLAST
LamG	811	938	4.37e-28	SMART
EGF	959	995	6.55e-1	SMART
LamG	1036	1172	2.08e-11	SMART
transmembrane domain	1240	1262	N/A	INTRINSIC

Meta Mutation Damage Score

0.1773

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,259,367		probably benign	Het
Adam1a	T	A	5: 121,519,586	Y548F	probably benign	Het
Armc9	T	C	1: 86,199,892	L83P	probably damaging	Het
BC051665	A	T	13: 60,784,530		probably benign	Het
Casp3	A	G	8: 46,629,756	N3S	probably damaging	Het
Ccdc174	G	A	6: 91,888,089	M109I	probably benign	Het
Ccr6	T	A	17: 8,256,241	F93I	probably damaging	Het
Clvs2	T	C	10: 33,595,815	S165G	probably damaging	Het
Dennd5a	C	A	7: 109,905,120		probably null	Het
Dock2	T	A	11: 34,695,217	Y546F	probably benign	Het
Fat2	A	G	11: 55,267,575		probably null	Het
Focad	T	A	4: 88,279,244	Y625N	unknown	Het
Fyb	A	G	15: 6,579,954	K3E	probably damaging	Het
Gm14496	G	A	2: 181,991,337	D38N	probably benign	Het
Gm20403	T	C	12: 54,986,370	T54A	probably benign	Het
Gm9830	A	G	9: 44,464,259		noncoding transcript	Het
Hectd1	A	T	12: 51,745,494	S2487R	probably damaging	Het
Il5ra	A	G	6: 106,738,272	L175S	probably benign	Het
Itgav	C	T	2: 83,803,255	R983C	probably damaging	Het
Kcna10	T	C	3: 107,194,716	V221A	probably damaging	Het
Kif13b	G	A	14: 64,669,671	V35I	probably benign	Het
Kif6	G	A	17: 49,755,230	E473K	probably damaging	Het
Mfsd14a	T	C	3: 116,632,393	T452A	probably benign	Het
Mllt1	A	G	17: 56,897,398	S382P	probably benign	Het
Myo15b	T	C	11: 115,866,572	W1083R	probably damaging	Het
Nell2	T	C	15: 95,435,157	I174V	probably damaging	Het
Noct	G	A	3: 51,249,696		probably null	Het
Nvl	A	T	1: 181,135,074		probably benign	Het
Ofcc1	T	C	13: 40,097,119	S574G	probably benign	Het
Olfr1248	A	T	2: 89,617,580	M204K	possibly damaging	Het
Olfr512	G	A	7: 108,714,132	V248I	probably damaging	Het
Olfr749	T	C	14: 50,736,224	M313V	probably benign	Het
Pip5k1a	A	T	3: 95,065,496	S415T	probably damaging	Het
Pkhd1	G	A	1: 20,553,517	P785S	probably damaging	Het
Plcg2	A	G	8: 117,612,994	Y1048C	probably damaging	Het
Ppp3cb	A	T	14: 20,520,652	V337E	probably benign	Het
Prkg2	T	C	5: 98,966,509		probably benign	Het
Prl7a2	T	G	13: 27,659,106	Y238S	probably benign	Het
Psg28	T	A	7: 18,427,879	D233V	probably damaging	Het
Rad50	A	G	11: 53,698,209	C221R	probably benign	Het
Rgl3	A	G	9: 21,975,958		probably benign	Het
Rgsl1	T	A	1: 153,825,268		probably benign	Het
Ror1	C	A	4: 100,441,874	R815S	probably damaging	Het
Rrp1b	C	A	17: 32,056,560	D360E	probably benign	Het
Ryr3	T	C	2: 112,666,335	Q3682R	possibly damaging	Het
Sdr42e1	A	T	8: 117,662,877	F342I	possibly damaging	Het
Setd5	A	G	6: 113,151,153	R1337G	probably benign	Het
Siglecf	T	C	7: 43,351,716	V36A	probably damaging	Het
Slc4a5	G	A	6: 83,262,560	G152D	probably damaging	Het
Sptbn4	T	G	7: 27,364,162	M2280L	probably benign	Het
Syngr2	T	C	11: 117,812,580	I74T	probably damaging	Het
Tm9sf1	T	C	14: 55,641,409	I175M	possibly damaging	Het
Tmc3	A	G	7: 83,609,308	E502G	probably damaging	Het
Tph1	T	A	7: 46,662,039	D88V	possibly damaging	Het
Tpr	A	G	1: 150,419,940	K979E	possibly damaging	Het
Usp47	A	G	7: 112,092,727	T799A	probably benign	Het
Utf1	A	G	7: 139,944,007	E45G	possibly damaging	Het
Vmn1r208	A	T	13: 22,772,602	C242S	probably damaging	Het
Wrnip1	T	C	13: 32,820,240	I498T	probably damaging	Het
Ypel2	T	A	11: 86,971,873	H18L	probably benign	Het
Zan	T	G	5: 137,421,848	D2849A	unknown	Het
Zfp647	A	T	15: 76,911,660	F267I	probably damaging	Het
Zfp786	G	T	6: 47,820,971	H344Q	possibly damaging	Het
Zswim3	G	T	2: 164,820,694	A365S	probably benign	Het
Zswim5	T	C	4: 116,973,041	W538R	probably damaging	Het

Other mutations in Cntnap5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Cntnap5c	APN	17	58162277	missense	probably benign	0.00
IGL00543:Cntnap5c	APN	17	58294350	missense	probably benign
IGL00679:Cntnap5c	APN	17	58055678	missense	probably damaging	0.98
IGL00942:Cntnap5c	APN	17	57769598	missense	probably benign	0.03
IGL01352:Cntnap5c	APN	17	58293901	missense	probably benign	0.00
IGL01822:Cntnap5c	APN	17	58055705	missense	probably damaging	0.99
IGL01864:Cntnap5c	APN	17	58410242	missense	probably benign
IGL01922:Cntnap5c	APN	17	58330119	missense	possibly damaging	0.95
IGL02111:Cntnap5c	APN	17	58102108	missense	probably damaging	1.00
IGL02112:Cntnap5c	APN	17	58313858	missense	probably benign	0.00
IGL02259:Cntnap5c	APN	17	58034862	missense	probably damaging	0.98
IGL02270:Cntnap5c	APN	17	58034853	missense	probably benign	0.08
IGL02312:Cntnap5c	APN	17	58138699	missense	probably benign	0.09
IGL02456:Cntnap5c	APN	17	58407744	splice site	probably benign
IGL02755:Cntnap5c	APN	17	58364194	missense	probably benign	0.02
IGL02955:Cntnap5c	APN	17	57892102	splice site	probably benign
IGL03001:Cntnap5c	APN	17	58055639	missense	probably damaging	1.00
IGL03012:Cntnap5c	APN	17	58359234	missense	probably benign	0.01
IGL03243:Cntnap5c	APN	17	58102176	missense	probably benign	0.01
IGL03375:Cntnap5c	APN	17	58162205	missense	possibly damaging	0.94
IGL02802:Cntnap5c	UTSW	17	58305684	missense	probably benign	0.04
LCD18:Cntnap5c	UTSW	17	58162160	intron	probably benign
R0003:Cntnap5c	UTSW	17	58199017	missense	probably benign
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0179:Cntnap5c	UTSW	17	57769625	missense	probably benign	0.19
R0244:Cntnap5c	UTSW	17	58102168	missense	probably damaging	1.00
R0445:Cntnap5c	UTSW	17	58104743	missense	probably benign	0.01
R0626:Cntnap5c	UTSW	17	58042427	missense	probably benign	0.29
R0675:Cntnap5c	UTSW	17	58034995	missense	probably damaging	1.00
R0681:Cntnap5c	UTSW	17	58305555	missense	possibly damaging	0.91
R0699:Cntnap5c	UTSW	17	58042498	missense	probably damaging	1.00
R0927:Cntnap5c	UTSW	17	58042558	missense	possibly damaging	0.78
R1081:Cntnap5c	UTSW	17	58305525	missense	possibly damaging	0.90
R1132:Cntnap5c	UTSW	17	58294356	missense	probably damaging	1.00
R1175:Cntnap5c	UTSW	17	58364246	missense	possibly damaging	0.51
R1640:Cntnap5c	UTSW	17	58395294	missense	probably benign	0.01
R1664:Cntnap5c	UTSW	17	58293990	missense	probably benign	0.00
R1758:Cntnap5c	UTSW	17	58042550	missense	probably damaging	1.00
R1785:Cntnap5c	UTSW	17	58162291	missense	probably benign	0.00
R1789:Cntnap5c	UTSW	17	58013921	missense	probably damaging	1.00
R1968:Cntnap5c	UTSW	17	58359296	missense	probably damaging	1.00
R2041:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R2041:Cntnap5c	UTSW	17	58198989	missense	probably benign	0.02
R2073:Cntnap5c	UTSW	17	58305552	missense	possibly damaging	0.58
R2093:Cntnap5c	UTSW	17	58199000	missense	probably benign	0.00
R2134:Cntnap5c	UTSW	17	58407722	missense	probably damaging	1.00
R2153:Cntnap5c	UTSW	17	58055671	missense	possibly damaging	0.90
R2256:Cntnap5c	UTSW	17	58330315	missense	probably benign	0.00
R2847:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2848:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2850:Cntnap5c	UTSW	17	58410348	utr 3 prime	probably benign
R3008:Cntnap5c	UTSW	17	58359209	missense	probably damaging	1.00
R3714:Cntnap5c	UTSW	17	57892067	nonsense	probably null
R3720:Cntnap5c	UTSW	17	58330202	missense	probably benign
R3755:Cntnap5c	UTSW	17	58104599	missense	possibly damaging	0.82
R4001:Cntnap5c	UTSW	17	58407740	critical splice donor site	probably null
R4619:Cntnap5c	UTSW	17	58410268	missense	probably benign
R5146:Cntnap5c	UTSW	17	58013847	missense	probably damaging	0.96
R5309:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5312:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5722:Cntnap5c	UTSW	17	58313857	missense	probably benign	0.01
R5974:Cntnap5c	UTSW	17	57876485	missense	probably benign	0.00
R6017:Cntnap5c	UTSW	17	58104698	missense	probably benign	0.41
R6059:Cntnap5c	UTSW	17	58313712	missense	probably damaging	0.99
R6152:Cntnap5c	UTSW	17	58286886	missense	possibly damaging	0.65
R6182:Cntnap5c	UTSW	17	57876395	missense	probably benign	0.00
R6298:Cntnap5c	UTSW	17	58104752	missense	probably damaging	1.00
R6301:Cntnap5c	UTSW	17	57892037	missense	probably benign	0.01
R6514:Cntnap5c	UTSW	17	58330170	missense	probably damaging	0.96
R6583:Cntnap5c	UTSW	17	58330277	missense	probably damaging	1.00
R6688:Cntnap5c	UTSW	17	58293904	missense	possibly damaging	0.71
R6781:Cntnap5c	UTSW	17	58138653	nonsense	probably null
R6866:Cntnap5c	UTSW	17	58092294	missense	probably benign
R6906:Cntnap5c	UTSW	17	58395307	missense	probably benign	0.18
R6911:Cntnap5c	UTSW	17	57892014	missense	probably damaging	1.00
R6919:Cntnap5c	UTSW	17	58293953	missense	probably benign	0.02
R6923:Cntnap5c	UTSW	17	58092350	missense	possibly damaging	0.96
R6925:Cntnap5c	UTSW	17	58395266	missense	probably benign	0.39
R6982:Cntnap5c	UTSW	17	58092252	missense	possibly damaging	0.77
R7144:Cntnap5c	UTSW	17	58286888	missense	probably benign
R7422:Cntnap5c	UTSW	17	58410231	nonsense	probably null
R7797:Cntnap5c	UTSW	17	58359275	missense	probably benign	0.11
R7830:Cntnap5c	UTSW	17	58162250	missense	probably damaging	1.00
R8169:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R8351:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8352:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8451:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8452:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8696:Cntnap5c	UTSW	17	58294299	missense	probably damaging	1.00
R8725:Cntnap5c	UTSW	17	58055668	missense	probably damaging	1.00
R8838:Cntnap5c	UTSW	17	57891969	missense
R8901:Cntnap5c	UTSW	17	58330161	missense	probably benign	0.03
R8911:Cntnap5c	UTSW	17	58199048	missense	probably damaging	0.98
R9010:Cntnap5c	UTSW	17	58364164	missense	probably benign	0.00
R9065:Cntnap5c	UTSW	17	58138647	missense	probably damaging	1.00
R9082:Cntnap5c	UTSW	17	58330340	missense	probably damaging	0.98
R9122:Cntnap5c	UTSW	17	58104606	missense	probably benign	0.01
R9137:Cntnap5c	UTSW	17	58294208	splice site	probably benign
R9176:Cntnap5c	UTSW	17	58313735	missense	probably damaging	1.00
R9179:Cntnap5c	UTSW	17	58293917	missense	probably benign	0.14
R9352:Cntnap5c	UTSW	17	58092468	missense	probably benign	0.01
R9485:Cntnap5c	UTSW	17	58102108	missense	probably damaging	1.00
R9558:Cntnap5c	UTSW	17	58364162	critical splice acceptor site	probably null
R9792:Cntnap5c	UTSW	17	58102197	missense	probably benign	0.03
R9793:Cntnap5c	UTSW	17	58102197	missense	probably benign	0.03
R9795:Cntnap5c	UTSW	17	58102197	missense	probably benign	0.03
RF010:Cntnap5c	UTSW	17	58286795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATACTTGTGATTATATGGCTCAGTA -3'
(R):5'- ACTTCTCAGCTGAGGTACACAT -3'

Sequencing Primer
(F):5'- GGTTCACCACAAACTGCT -3'
(R):5'- ATGACCAGACCTTTGTGGATCACTG -3'

Posted On

2014-10-02