Incidental Mutation 'R2177:Man1a2'
ID236923
Institutional Source Beutler Lab
Gene Symbol Man1a2
Ensembl Gene ENSMUSG00000008763
Gene Namemannosidase, alpha, class 1A, member 2
SynonymsMan1b
MMRRC Submission 040179-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2177 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100562208-100685503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100632531 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 308 (I308N)
Ref Sequence ENSEMBL: ENSMUSP00000008907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008907] [ENSMUST00000130066]
Predicted Effect probably damaging
Transcript: ENSMUST00000008907
AA Change: I308N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: I308N

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
coiled coil region 101 153 N/A INTRINSIC
low complexity region 155 170 N/A INTRINSIC
Pfam:Glyco_hydro_47 187 626 2.8e-156 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130066
AA Change: I198N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116489
Gene: ENSMUSG00000008763
AA Change: I198N

DomainStartEndE-ValueType
coiled coil region 18 70 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
Pfam:Glyco_hydro_47 104 179 1.2e-23 PFAM
Pfam:Glyco_hydro_47 174 246 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200265
Meta Mutation Damage Score 0.9548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Ch25h G T 19: 34,474,697 L144M probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Gbf1 T C 19: 46,265,670 S599P probably benign Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Krtap16-1 A G 11: 99,986,449 V43A probably damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Ulk2 T A 11: 61,791,509 T727S probably benign Het
Usp53 T C 3: 122,936,057 E756G probably damaging Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Man1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Man1a2 APN 3 100644557 missense probably damaging 1.00
IGL02009:Man1a2 APN 3 100684662 missense probably damaging 0.99
IGL02097:Man1a2 APN 3 100582131 missense possibly damaging 0.68
IGL02395:Man1a2 APN 3 100644537 splice site probably null
IGL02441:Man1a2 APN 3 100591873 missense probably benign 0.01
R0043:Man1a2 UTSW 3 100587880 missense probably damaging 1.00
R0064:Man1a2 UTSW 3 100591883 missense possibly damaging 0.95
R0217:Man1a2 UTSW 3 100617037 missense possibly damaging 0.61
R0266:Man1a2 UTSW 3 100582034 missense probably damaging 1.00
R0284:Man1a2 UTSW 3 100684786 missense probably damaging 0.98
R0633:Man1a2 UTSW 3 100684575 missense possibly damaging 0.80
R1074:Man1a2 UTSW 3 100656086 missense possibly damaging 0.68
R2167:Man1a2 UTSW 3 100591900 missense probably damaging 1.00
R3822:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R4361:Man1a2 UTSW 3 100656042 missense probably benign
R4652:Man1a2 UTSW 3 100632561 missense probably damaging 1.00
R4871:Man1a2 UTSW 3 100617056 missense probably damaging 1.00
R5153:Man1a2 UTSW 3 100656263 missense probably damaging 1.00
R5182:Man1a2 UTSW 3 100647017 missense probably damaging 0.99
R5201:Man1a2 UTSW 3 100617012 missense probably benign
R5251:Man1a2 UTSW 3 100620099 missense probably damaging 1.00
R6135:Man1a2 UTSW 3 100684932 start gained probably benign
R6793:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R6886:Man1a2 UTSW 3 100656071 missense probably benign 0.00
R7209:Man1a2 UTSW 3 100647079 missense unknown
R7224:Man1a2 UTSW 3 100582053 missense possibly damaging 0.85
R7308:Man1a2 UTSW 3 100620105 missense probably damaging 1.00
R7815:Man1a2 UTSW 3 100656179 missense probably damaging 0.99
R7826:Man1a2 UTSW 3 100582139 missense probably damaging 1.00
R8427:Man1a2 UTSW 3 100684685 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCTGTCTCAAAGTAAAGGACAG -3'
(R):5'- TGATGTGTGACTGCTTACCAC -3'

Sequencing Primer
(F):5'- CTAAGGAAAGGCTTTGATGTTCTTC -3'
(R):5'- GTGACTGCTTACCACACGCC -3'
Posted On2014-10-02