Incidental Mutation 'R2177:Krtap16-1'
ID236956
Institutional Source Beutler Lab
Gene Symbol Krtap16-1
Ensembl Gene ENSMUSG00000078253
Gene Namekeratin associated protein 16-1
SynonymsAI450886
MMRRC Submission 040179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2177 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99984710-99986597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99986449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000100671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105050]
Predicted Effect probably damaging
Transcript: ENSMUST00000105050
AA Change: V43A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100671
Gene: ENSMUSG00000078253
AA Change: V43A

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 45 92 3.4e-8 PFAM
Pfam:Keratin_B2_2 88 132 1.8e-11 PFAM
Pfam:Keratin_B2_2 142 191 1.6e-7 PFAM
Pfam:Keratin_B2_2 172 221 9.9e-9 PFAM
Pfam:Keratin_B2_2 198 246 8.2e-5 PFAM
Pfam:Keratin_B2_2 212 266 3.3e-4 PFAM
low complexity region 282 299 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118454
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Ch25h G T 19: 34,474,697 L144M probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Gbf1 T C 19: 46,265,670 S599P probably benign Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Man1a2 A T 3: 100,632,531 I308N probably damaging Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Ulk2 T A 11: 61,791,509 T727S probably benign Het
Usp53 T C 3: 122,936,057 E756G probably damaging Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Krtap16-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Krtap16-1 APN 11 99985731 nonsense probably null
IGL00578:Krtap16-1 APN 11 99985295 missense probably benign 0.00
IGL02324:Krtap16-1 APN 11 99986303 missense probably damaging 0.99
R0200:Krtap16-1 UTSW 11 99985297 missense probably damaging 0.96
R0617:Krtap16-1 UTSW 11 99986495 missense probably damaging 1.00
R1699:Krtap16-1 UTSW 11 99986026 missense probably damaging 1.00
R1785:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2130:Krtap16-1 UTSW 11 99985776 nonsense probably null
R4455:Krtap16-1 UTSW 11 99985733 missense probably benign 0.44
R4716:Krtap16-1 UTSW 11 99985174 missense probably damaging 0.99
R5111:Krtap16-1 UTSW 11 99986552 missense possibly damaging 0.90
R5122:Krtap16-1 UTSW 11 99985697 missense probably damaging 0.96
R5254:Krtap16-1 UTSW 11 99985598 nonsense probably null
R5481:Krtap16-1 UTSW 11 99985327 missense probably damaging 0.98
R6557:Krtap16-1 UTSW 11 99985130 missense possibly damaging 0.90
R6884:Krtap16-1 UTSW 11 99986458 nonsense probably null
R7085:Krtap16-1 UTSW 11 99986285 missense possibly damaging 0.56
R7675:Krtap16-1 UTSW 11 99985433 missense possibly damaging 0.52
Z1176:Krtap16-1 UTSW 11 99985597 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCACAGCACACAGGTTGAC -3'
(R):5'- AAGGGAGATACCACACTCAGGC -3'

Sequencing Primer
(F):5'- TTGACAGCAACTGCCCATAGAG -3'
(R):5'- TCAGGCAGCACTCACTCC -3'
Posted On2014-10-02