Mutagenetix > Incidental Mutation

Incidental Mutation 'R2177:Parp4'

236959

Institutional Source

Beutler Lab

Gene Symbol

Parp4

Ensembl Gene

ENSMUSG00000054509

Gene Name

poly (ADP-ribose) polymerase family, member 4

Synonyms

p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik

MMRRC Submission

040179-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R2177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56575619-56659794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56659289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1923 (R1923S)

Ref Sequence

ENSEMBL: ENSMUSP00000124258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161553]

AlphaFold

E9PYK3

Predicted Effect

unknown
Transcript: ENSMUST00000161553
AA Change: R1923S

SMART Domains

Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: R1923S

Domain	Start	End	E-Value	Type
BRCT	3	84	4.32e-9	SMART
low complexity region	97	104	N/A	INTRINSIC
SCOP:d1a26_1	252	352	2e-19	SMART
Pfam:PARP	371	559	1.8e-50	PFAM
VIT	600	728	1.5e-57	SMART
VWA	867	1030	6.08e-13	SMART
Blast:14_3_3	1149	1205	5e-10	BLAST
low complexity region	1255	1264	N/A	INTRINSIC
low complexity region	1348	1362	N/A	INTRINSIC
low complexity region	1371	1394	N/A	INTRINSIC
internal_repeat_1	1395	1416	4.48e-6	PROSPERO
Pfam:Drf_FH1	1443	1542	3.3e-15	PFAM
low complexity region	1553	1587	N/A	INTRINSIC
internal_repeat_2	1588	1608	2.45e-5	PROSPERO
low complexity region	1695	1708	N/A	INTRINSIC
low complexity region	1739	1750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162312

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	A	5: 87,972,453	N356K	probably damaging	Het
Acap2	C	T	16: 31,133,528		probably null	Het
Adamts19	T	C	18: 58,954,554	L552P	possibly damaging	Het
Adamts2	T	A	11: 50,777,228	M539K	probably damaging	Het
Aplp1	A	T	7: 30,442,521	C210*	probably null	Het
Apoa1	A	T	9: 46,230,073	K156*	probably null	Het
AW551984	G	A	9: 39,599,815	R159C	probably benign	Het
Bok	C	T	1: 93,695,065	Q112*	probably null	Het
Cfap57	T	G	4: 118,606,688	I323L	probably benign	Het
Cfap69	T	A	5: 5,625,803	E270D	probably damaging	Het
Ch25h	G	T	19: 34,474,697	L144M	probably damaging	Het
Clcn6	T	A	4: 148,014,600	I429F	possibly damaging	Het
Cpb1	T	A	3: 20,266,447	T115S	probably benign	Het
Csf1r	T	A	18: 61,114,943		probably benign	Het
Ddx6	A	G	9: 44,627,731	T279A	probably damaging	Het
Dnah8	A	G	17: 30,653,393	H452R	probably benign	Het
Dscam	T	A	16: 96,610,324	D1784V	probably damaging	Het
Exo1	T	A	1: 175,882,890		probably null	Het
Fcho1	A	G	8: 71,712,261	S459P	probably damaging	Het
Fxyd4	C	T	6: 117,934,432	A56T	probably damaging	Het
Gbf1	T	C	19: 46,265,670	S599P	probably benign	Het
Iqce	T	C	5: 140,691,593		probably benign	Het
Kat2a	A	G	11: 100,710,822	F256L	probably damaging	Het
Klk1b1	G	T	7: 43,969,271	R24L	possibly damaging	Het
Krtap16-1	A	G	11: 99,986,449	V43A	probably damaging	Het
Maea	C	G	5: 33,371,690	Q326E	probably benign	Het
Man1a2	A	T	3: 100,632,531	I308N	probably damaging	Het
Marf1	G	T	16: 14,152,607	R83S	probably benign	Het
Me3	A	C	7: 89,633,070	T54P	probably benign	Het
Mme	A	T	3: 63,301,005	I63L	probably benign	Het
Mmel1	A	G	4: 154,894,103	N664S	probably damaging	Het
Mrgprb2	A	G	7: 48,552,380	V199A	probably benign	Het
Mrpl36	T	A	13: 73,331,469	F33I	probably benign	Het
Nlrp4e	A	T	7: 23,355,261	T947S	probably benign	Het
Olfr297	G	A	7: 86,527,662	V302I	probably benign	Het
Olfr32	T	A	2: 90,138,464	H225L	possibly damaging	Het
Olfr922	A	T	9: 38,816,186	I228F	possibly damaging	Het
Pcm1	T	C	8: 41,275,965	V658A	probably benign	Het
Pkhd1l1	A	G	15: 44,459,395	S26G	probably benign	Het
Prom1	A	T	5: 44,026,739	H433Q	possibly damaging	Het
Rab7	T	C	6: 88,005,081	D104G	probably damaging	Het
Rabgap1l	A	G	1: 160,724,062	V282A	possibly damaging	Het
Rdh13	T	C	7: 4,427,667	E264G	possibly damaging	Het
Rock1	C	G	18: 10,070,263	R1270T	probably benign	Het
Sdhaf4	C	T	1: 23,996,289	G93R	probably damaging	Het
Sec24a	T	C	11: 51,704,401	T910A	probably benign	Het
Sesn1	A	G	10: 41,903,782	H345R	possibly damaging	Het
Snx4	T	A	16: 33,286,058		probably null	Het
Tchh	A	G	3: 93,444,132	E293G	unknown	Het
Tmem2	T	C	19: 21,811,785	S528P	possibly damaging	Het
Ulk2	T	A	11: 61,791,509	T727S	probably benign	Het
Usp53	T	C	3: 122,936,057	E756G	probably damaging	Het
Vmn2r68	G	A	7: 85,221,915	A720V	probably benign	Het
Vmn2r79	A	G	7: 86,996,631	N56S	possibly damaging	Het
Washc5	A	T	15: 59,363,269	Y263*	probably null	Het
Zfp119b	A	T	17: 55,938,639	C516S	probably damaging	Het

Other mutations in Parp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Parp4	APN	14	56616460	missense	possibly damaging	0.82
IGL00571:Parp4	APN	14	56647353	missense	unknown
IGL00737:Parp4	APN	14	56584163	missense	probably damaging	0.99
IGL00793:Parp4	APN	14	56602877	missense	possibly damaging	0.73
IGL01108:Parp4	APN	14	56607440	missense	probably benign	0.01
IGL01131:Parp4	APN	14	56585760	splice site	probably benign
IGL01485:Parp4	APN	14	56622204	missense	possibly damaging	0.54
IGL01704:Parp4	APN	14	56602326	missense	probably damaging	0.99
IGL01993:Parp4	APN	14	56610788	missense	possibly damaging	0.82
IGL02125:Parp4	APN	14	56590502	missense	probably benign	0.33
IGL02851:Parp4	APN	14	56648869	missense	unknown
IGL02863:Parp4	APN	14	56648786	missense	unknown
IGL03065:Parp4	APN	14	56637869	missense	probably benign	0.09
IGL03117:Parp4	APN	14	56602856	missense	probably benign	0.17
IGL03271:Parp4	APN	14	56585625	missense	probably benign	0.10
IGL03309:Parp4	APN	14	56587808	missense	probably benign	0.11
IGL03408:Parp4	APN	14	56602408	missense	probably damaging	0.99
poisonous	UTSW	14	56635748	missense	possibly damaging	0.65
R0515_Parp4_195	UTSW	14	56613667	missense	probably damaging	1.00
toxic	UTSW	14	56629158	missense	probably benign	0.28
venomous	UTSW	14	56589898	missense	possibly damaging	0.92
virulent	UTSW	14	56587778	missense	probably damaging	0.97
R0278:Parp4	UTSW	14	56607523	missense	probably damaging	0.99
R0320:Parp4	UTSW	14	56588496	critical splice donor site	probably null
R0445:Parp4	UTSW	14	56602748	splice site	probably null
R0452:Parp4	UTSW	14	56648843	missense	unknown
R0511:Parp4	UTSW	14	56635715	splice site	probably benign
R0515:Parp4	UTSW	14	56613667	missense	probably damaging	1.00
R0608:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R0800:Parp4	UTSW	14	56589951	missense	probably benign	0.00
R0959:Parp4	UTSW	14	56648119	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1342:Parp4	UTSW	14	56590397	missense	probably damaging	1.00
R1520:Parp4	UTSW	14	56598406	missense	probably damaging	1.00
R1565:Parp4	UTSW	14	56589872	splice site	probably benign
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1649:Parp4	UTSW	14	56590428	missense	possibly damaging	0.95
R1666:Parp4	UTSW	14	56624163	missense	possibly damaging	0.91
R1781:Parp4	UTSW	14	56627381	splice site	probably null
R1799:Parp4	UTSW	14	56648132	missense	unknown
R1823:Parp4	UTSW	14	56589872	splice site	probably benign
R1859:Parp4	UTSW	14	56648915	missense	unknown
R1919:Parp4	UTSW	14	56624017	missense	probably damaging	1.00
R2000:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R2032:Parp4	UTSW	14	56629096	missense	possibly damaging	0.71
R2034:Parp4	UTSW	14	56634263	missense	probably damaging	1.00
R2291:Parp4	UTSW	14	56613817	missense	probably damaging	1.00
R2865:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R3012:Parp4	UTSW	14	56595416	critical splice donor site	probably null
R3841:Parp4	UTSW	14	56587778	missense	probably damaging	0.97
R3913:Parp4	UTSW	14	56620518	missense	probably damaging	1.00
R4064:Parp4	UTSW	14	56624140	missense	probably benign	0.06
R4201:Parp4	UTSW	14	56592391	missense	possibly damaging	0.95
R4288:Parp4	UTSW	14	56607494	missense	probably damaging	1.00
R4360:Parp4	UTSW	14	56629204	missense	possibly damaging	0.89
R4506:Parp4	UTSW	14	56652304	missense	unknown
R4577:Parp4	UTSW	14	56590410	missense	probably benign	0.33
R4633:Parp4	UTSW	14	56647591	missense	unknown
R4762:Parp4	UTSW	14	56610810	missense	probably damaging	1.00
R4836:Parp4	UTSW	14	56585738	missense	probably benign	0.00
R4974:Parp4	UTSW	14	56589898	missense	possibly damaging	0.92
R5049:Parp4	UTSW	14	56635731	missense	possibly damaging	0.81
R5479:Parp4	UTSW	14	56624095	missense	probably benign	0.01
R5683:Parp4	UTSW	14	56647429	nonsense	probably null
R5884:Parp4	UTSW	14	56614750	missense	probably damaging	1.00
R5965:Parp4	UTSW	14	56624032	missense	probably benign	0.11
R6001:Parp4	UTSW	14	56641283	missense	probably benign	0.01
R6027:Parp4	UTSW	14	56629158	missense	probably benign	0.28
R6230:Parp4	UTSW	14	56607533	missense	probably damaging	1.00
R6242:Parp4	UTSW	14	56595399	nonsense	probably null
R6355:Parp4	UTSW	14	56602300	missense	possibly damaging	0.61
R6414:Parp4	UTSW	14	56627381	splice site	probably null
R6418:Parp4	UTSW	14	56620651	critical splice donor site	probably null
R6477:Parp4	UTSW	14	56647237	missense	probably benign	0.00
R6542:Parp4	UTSW	14	56647882	missense	unknown
R6759:Parp4	UTSW	14	56620490	missense	probably benign	0.10
R6995:Parp4	UTSW	14	56613739	missense	probably damaging	0.97
R7002:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R7026:Parp4	UTSW	14	56620592	missense	probably benign	0.01
R7062:Parp4	UTSW	14	56614759	missense	possibly damaging	0.48
R7101:Parp4	UTSW	14	56589973	missense	probably benign	0.02
R7124:Parp4	UTSW	14	56602799	missense	probably benign	0.11
R7162:Parp4	UTSW	14	56648876	missense	unknown
R7293:Parp4	UTSW	14	56647846	small deletion	probably benign
R7297:Parp4	UTSW	14	56647681	missense	not run
R7337:Parp4	UTSW	14	56602395	missense	probably damaging	1.00
R7539:Parp4	UTSW	14	56635755	missense	probably damaging	1.00
R7575:Parp4	UTSW	14	56637918	missense	probably benign	0.28
R7808:Parp4	UTSW	14	56635748	missense	possibly damaging	0.65
R7854:Parp4	UTSW	14	56659348	missense	unknown
R7960:Parp4	UTSW	14	56595251	splice site	probably null
R8152:Parp4	UTSW	14	56647246	missense	probably benign	0.00
R8344:Parp4	UTSW	14	56648729	missense	unknown
R8416:Parp4	UTSW	14	56587814	critical splice donor site	probably null
R8726:Parp4	UTSW	14	56629099	missense	probably benign	0.04
R8752:Parp4	UTSW	14	56648616	missense	unknown
R8804:Parp4	UTSW	14	56616443	nonsense	probably null
R9046:Parp4	UTSW	14	56627470	missense	probably damaging	0.98
R9176:Parp4	UTSW	14	56635817	missense	possibly damaging	0.54
R9303:Parp4	UTSW	14	56595333	frame shift	probably null
R9303:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9305:Parp4	UTSW	14	56595333	frame shift	probably null
R9305:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9360:Parp4	UTSW	14	56641318	critical splice donor site	probably null
R9430:Parp4	UTSW	14	56629216	missense	probably damaging	1.00
R9491:Parp4	UTSW	14	56595371	missense	probably damaging	0.99
RF020:Parp4	UTSW	14	56647349	missense	unknown
Z1177:Parp4	UTSW	14	56592367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGATGGAAGTCTCAAGATTTTG -3'
(R):5'- GGCTGTAGCTACATTTAACACG -3'

Sequencing Primer
(F):5'- GATTGAATACCACATTGCC -3'
(R):5'- TCTCAGCACTTGGAATGCAG -3'

Posted On

2014-10-02