Incidental Mutation 'R0173:Lzts3'
ID23696
Institutional Source Beutler Lab
Gene Symbol Lzts3
Ensembl Gene ENSMUSG00000037703
Gene Nameleucine zipper, putative tumor suppressor family member 3
SynonymsProsapip1
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location130632839-130642803 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 130634768 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 587 (*587G)
Ref Sequence ENSEMBL: ENSMUSP00000105889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000045761] [ENSMUST00000089561] [ENSMUST00000110260] [ENSMUST00000110262] [ENSMUST00000140581]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045761
AA Change: *701G
SMART Domains Protein: ENSMUSP00000037109
Gene: ENSMUSG00000037703
AA Change: *701G

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 665 1.4e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089561
AA Change: *701G
SMART Domains Protein: ENSMUSP00000086990
Gene: ENSMUSG00000037703
AA Change: *701G

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 666 2.1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110260
AA Change: *587G
SMART Domains Protein: ENSMUSP00000105889
Gene: ENSMUSG00000037703
AA Change: *587G

DomainStartEndE-ValueType
low complexity region 126 136 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 187 219 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
low complexity region 288 322 N/A INTRINSIC
Pfam:Fez1 351 552 1.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110262
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140581
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Meta Mutation Damage Score 0.9473 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Lzts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Lzts3 APN 2 130635445 missense probably damaging 0.99
IGL01541:Lzts3 APN 2 130636206 missense probably damaging 0.99
IGL01649:Lzts3 APN 2 130635431 missense probably damaging 0.98
IGL02746:Lzts3 APN 2 130636341 missense probably damaging 0.98
IGL02927:Lzts3 APN 2 130637957 utr 5 prime probably benign
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R1381:Lzts3 UTSW 2 130635299 missense probably damaging 0.99
R4127:Lzts3 UTSW 2 130635365 missense probably damaging 0.99
R4301:Lzts3 UTSW 2 130636438 missense probably damaging 0.99
R4588:Lzts3 UTSW 2 130634766 makesense probably null
R5289:Lzts3 UTSW 2 130636101 missense probably benign 0.18
R5878:Lzts3 UTSW 2 130636539 missense probably damaging 1.00
R5964:Lzts3 UTSW 2 130636288 missense probably damaging 0.99
R6193:Lzts3 UTSW 2 130637386 missense probably damaging 0.97
R7692:Lzts3 UTSW 2 130635386 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TAGCACTGGACAGATGGTGGTGAC -3'
(R):5'- TCATTGAGTATCAGAAACAGCTCCAGC -3'

Sequencing Primer
(F):5'- TGGGACCTCACCCCATTG -3'
(R):5'- ATGTATCAGCGCAACCAGCA -3'
Posted On2013-04-16