Incidental Mutation 'R2177:Acap2'
ID 236963
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms Centb2, 9530039J15Rik
MMRRC Submission 040179-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R2177 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 30911230-31020063 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 30952346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000058033] [ENSMUST00000058033] [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000229010] [ENSMUST00000229010] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230614] [ENSMUST00000230614] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125] [ENSMUST00000231125] [ENSMUST00000231125] [ENSMUST00000231125]
AlphaFold Q6ZQK5
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably null
Transcript: ENSMUST00000231125
Predicted Effect probably null
Transcript: ENSMUST00000231125
Predicted Effect probably null
Transcript: ENSMUST00000231125
Predicted Effect probably null
Transcript: ENSMUST00000231125
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 88,120,312 (GRCm39) N356K probably damaging Het
Adamts19 T C 18: 59,087,626 (GRCm39) L552P possibly damaging Het
Adamts2 T A 11: 50,668,055 (GRCm39) M539K probably damaging Het
Aplp1 A T 7: 30,141,946 (GRCm39) C210* probably null Het
Apoa1 A T 9: 46,141,371 (GRCm39) K156* probably null Het
AW551984 G A 9: 39,511,111 (GRCm39) R159C probably benign Het
Bok C T 1: 93,622,787 (GRCm39) Q112* probably null Het
Cemip2 T C 19: 21,789,149 (GRCm39) S528P possibly damaging Het
Cfap57 T G 4: 118,463,885 (GRCm39) I323L probably benign Het
Cfap69 T A 5: 5,675,803 (GRCm39) E270D probably damaging Het
Ch25h G T 19: 34,452,097 (GRCm39) L144M probably damaging Het
Clcn6 T A 4: 148,099,057 (GRCm39) I429F possibly damaging Het
Cpb1 T A 3: 20,320,611 (GRCm39) T115S probably benign Het
Csf1r T A 18: 61,248,015 (GRCm39) probably benign Het
Ddx6 A G 9: 44,539,028 (GRCm39) T279A probably damaging Het
Dnah8 A G 17: 30,872,367 (GRCm39) H452R probably benign Het
Dscam T A 16: 96,411,524 (GRCm39) D1784V probably damaging Het
Exo1 T A 1: 175,710,456 (GRCm39) probably null Het
Fcho1 A G 8: 72,164,905 (GRCm39) S459P probably damaging Het
Fxyd4 C T 6: 117,911,393 (GRCm39) A56T probably damaging Het
Gbf1 T C 19: 46,254,109 (GRCm39) S599P probably benign Het
Iqce T C 5: 140,677,348 (GRCm39) probably benign Het
Kat2a A G 11: 100,601,648 (GRCm39) F256L probably damaging Het
Klk1b1 G T 7: 43,618,695 (GRCm39) R24L possibly damaging Het
Krtap16-1 A G 11: 99,877,275 (GRCm39) V43A probably damaging Het
Maea C G 5: 33,529,034 (GRCm39) Q326E probably benign Het
Man1a2 A T 3: 100,539,847 (GRCm39) I308N probably damaging Het
Marf1 G T 16: 13,970,471 (GRCm39) R83S probably benign Het
Me3 A C 7: 89,282,278 (GRCm39) T54P probably benign Het
Mme A T 3: 63,208,426 (GRCm39) I63L probably benign Het
Mmel1 A G 4: 154,978,560 (GRCm39) N664S probably damaging Het
Mrgprb2 A G 7: 48,202,128 (GRCm39) V199A probably benign Het
Mrpl36 T A 13: 73,479,588 (GRCm39) F33I probably benign Het
Nlrp4e A T 7: 23,054,686 (GRCm39) T947S probably benign Het
Or14c45 G A 7: 86,176,870 (GRCm39) V302I probably benign Het
Or4b1d T A 2: 89,968,808 (GRCm39) H225L possibly damaging Het
Or8b55 A T 9: 38,727,482 (GRCm39) I228F possibly damaging Het
Parp4 A T 14: 56,896,746 (GRCm39) R1923S unknown Het
Pcm1 T C 8: 41,729,002 (GRCm39) V658A probably benign Het
Pkhd1l1 A G 15: 44,322,791 (GRCm39) S26G probably benign Het
Prom1 A T 5: 44,184,081 (GRCm39) H433Q possibly damaging Het
Rab7 T C 6: 87,982,063 (GRCm39) D104G probably damaging Het
Rabgap1l A G 1: 160,551,632 (GRCm39) V282A possibly damaging Het
Rdh13 T C 7: 4,430,666 (GRCm39) E264G possibly damaging Het
Rock1 C G 18: 10,070,263 (GRCm39) R1270T probably benign Het
Sdhaf4 C T 1: 24,035,370 (GRCm39) G93R probably damaging Het
Sec24a T C 11: 51,595,228 (GRCm39) T910A probably benign Het
Sesn1 A G 10: 41,779,778 (GRCm39) H345R possibly damaging Het
Snx4 T A 16: 33,106,428 (GRCm39) probably null Het
Tchh A G 3: 93,351,439 (GRCm39) E293G unknown Het
Ulk2 T A 11: 61,682,335 (GRCm39) T727S probably benign Het
Usp53 T C 3: 122,729,706 (GRCm39) E756G probably damaging Het
Vmn2r68 G A 7: 84,871,123 (GRCm39) A720V probably benign Het
Vmn2r79 A G 7: 86,645,839 (GRCm39) N56S possibly damaging Het
Washc5 A T 15: 59,235,118 (GRCm39) Y263* probably null Het
Zfp119b A T 17: 56,245,639 (GRCm39) C516S probably damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 30,958,293 (GRCm39) missense probably damaging 1.00
IGL01330:Acap2 APN 16 30,973,495 (GRCm39) missense probably damaging 1.00
IGL01420:Acap2 APN 16 30,920,637 (GRCm39) splice site probably benign
IGL02064:Acap2 APN 16 30,946,146 (GRCm39) missense probably damaging 1.00
IGL02173:Acap2 APN 16 30,926,965 (GRCm39) missense possibly damaging 0.68
IGL02453:Acap2 APN 16 30,950,075 (GRCm39) splice site probably null
IGL02883:Acap2 APN 16 30,915,163 (GRCm39) unclassified probably benign
IGL03203:Acap2 APN 16 30,915,163 (GRCm39) unclassified probably benign
IGL03342:Acap2 APN 16 30,924,310 (GRCm39) missense probably damaging 1.00
R1251:Acap2 UTSW 16 30,926,989 (GRCm39) missense probably damaging 1.00
R1377:Acap2 UTSW 16 30,934,869 (GRCm39) missense probably damaging 1.00
R1432:Acap2 UTSW 16 30,929,901 (GRCm39) missense probably damaging 1.00
R1546:Acap2 UTSW 16 30,923,754 (GRCm39) nonsense probably null
R1594:Acap2 UTSW 16 30,946,205 (GRCm39) missense probably benign 0.01
R1829:Acap2 UTSW 16 30,929,752 (GRCm39) missense probably damaging 1.00
R1853:Acap2 UTSW 16 30,936,122 (GRCm39) missense probably damaging 1.00
R1970:Acap2 UTSW 16 30,952,345 (GRCm39) critical splice donor site probably null
R2023:Acap2 UTSW 16 30,938,233 (GRCm39) missense probably damaging 0.99
R2086:Acap2 UTSW 16 30,929,763 (GRCm39) missense probably damaging 1.00
R2145:Acap2 UTSW 16 30,924,342 (GRCm39) missense probably benign
R2214:Acap2 UTSW 16 30,926,946 (GRCm39) missense probably benign 0.19
R2392:Acap2 UTSW 16 30,958,458 (GRCm39) missense probably damaging 0.99
R2438:Acap2 UTSW 16 30,936,133 (GRCm39) missense probably damaging 1.00
R2913:Acap2 UTSW 16 30,934,887 (GRCm39) missense probably damaging 0.99
R4207:Acap2 UTSW 16 30,938,245 (GRCm39) missense probably damaging 0.99
R4274:Acap2 UTSW 16 30,926,932 (GRCm39) missense probably benign 0.01
R4814:Acap2 UTSW 16 30,926,944 (GRCm39) missense probably benign
R4860:Acap2 UTSW 16 30,922,317 (GRCm39) missense possibly damaging 0.92
R4860:Acap2 UTSW 16 30,922,317 (GRCm39) missense possibly damaging 0.92
R5310:Acap2 UTSW 16 30,952,427 (GRCm39) missense probably benign 0.00
R5345:Acap2 UTSW 16 30,926,944 (GRCm39) missense probably benign
R5388:Acap2 UTSW 16 30,928,543 (GRCm39) missense probably damaging 1.00
R5551:Acap2 UTSW 16 30,923,726 (GRCm39) missense probably damaging 1.00
R5578:Acap2 UTSW 16 30,926,932 (GRCm39) missense probably benign 0.00
R6341:Acap2 UTSW 16 30,924,364 (GRCm39) missense possibly damaging 0.86
R6659:Acap2 UTSW 16 30,950,133 (GRCm39) missense probably damaging 0.99
R6977:Acap2 UTSW 16 30,936,079 (GRCm39) missense probably damaging 1.00
R7262:Acap2 UTSW 16 30,946,137 (GRCm39) critical splice donor site probably null
R7304:Acap2 UTSW 16 30,926,934 (GRCm39) missense probably benign 0.05
R7310:Acap2 UTSW 16 30,926,972 (GRCm39) nonsense probably null
R7318:Acap2 UTSW 16 30,946,155 (GRCm39) missense probably damaging 1.00
R7514:Acap2 UTSW 16 30,973,385 (GRCm39) splice site probably null
R7875:Acap2 UTSW 16 30,958,459 (GRCm39) missense probably damaging 0.99
R8256:Acap2 UTSW 16 30,958,287 (GRCm39) critical splice donor site probably null
R9026:Acap2 UTSW 16 30,925,906 (GRCm39) missense probably damaging 0.99
R9177:Acap2 UTSW 16 30,955,392 (GRCm39) missense probably damaging 1.00
R9252:Acap2 UTSW 16 30,920,641 (GRCm39) critical splice donor site probably null
R9268:Acap2 UTSW 16 30,955,392 (GRCm39) missense probably damaging 1.00
R9329:Acap2 UTSW 16 30,946,238 (GRCm39) missense probably damaging 1.00
R9467:Acap2 UTSW 16 30,929,901 (GRCm39) missense possibly damaging 0.54
R9528:Acap2 UTSW 16 30,929,908 (GRCm39) missense possibly damaging 0.75
R9762:Acap2 UTSW 16 30,929,763 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTTAAGCCTCTTTTCAGTACC -3'
(R):5'- ACGTGCTTTCATACGACGTG -3'

Sequencing Primer
(F):5'- CTCTGATCACTACTTAAGACACGTG -3'
(R):5'- TTCATACGACGTGGACTCAG -3'
Posted On 2014-10-02