Incidental Mutation 'R0173:Rbl1'
ID23697
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene NameRB transcriptional corepressor like 1
Synonymsp107
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location157145893-157204534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157159685 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 894 (N894K)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
Predicted Effect probably benign
Transcript: ENSMUST00000029170
AA Change: N894K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: N894K

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Meta Mutation Damage Score 0.2231 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1445:Rbl1 UTSW 2 157193098 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1666:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1680:Rbl1 UTSW 2 157174783 missense probably damaging 0.97
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R2304:Rbl1 UTSW 2 157147631 missense probably benign 0.02
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
R7090:Rbl1 UTSW 2 157152900 missense probably benign 0.02
R7176:Rbl1 UTSW 2 157188325 missense probably damaging 1.00
R7769:Rbl1 UTSW 2 157191980 missense probably benign 0.01
R8032:Rbl1 UTSW 2 157187998 nonsense probably null
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- tctctctctctcCTTACACAGCCAC -3'
(R):5'- TGGAACACAGTCTAGAAGAGGCCC -3'

Sequencing Primer
(F):5'- tctcCTTACACAGCCACTTTCAC -3'
(R):5'- gaggcagaggcaggtgg -3'
Posted On2013-04-16