Incidental Mutation 'R2177:Ch25h'
ID236972
Institutional Source Beutler Lab
Gene Symbol Ch25h
Ensembl Gene ENSMUSG00000050370
Gene Namecholesterol 25-hydroxylase
Synonymsm25OH
MMRRC Submission 040179-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R2177 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34473786-34475135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34474697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 144 (L144M)
Ref Sequence ENSEMBL: ENSMUSP00000049683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050562]
Predicted Effect probably damaging
Transcript: ENSMUST00000050562
AA Change: L144M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049683
Gene: ENSMUSG00000050370
AA Change: L144M

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Pfam:FA_hydroxylase 128 263 3.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181777
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a and IgA in the sera, lungs, and intestinal mucosa and increased IgG2b and IgG3 in the intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Gbf1 T C 19: 46,265,670 S599P probably benign Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Krtap16-1 A G 11: 99,986,449 V43A probably damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Man1a2 A T 3: 100,632,531 I308N probably damaging Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Ulk2 T A 11: 61,791,509 T727S probably benign Het
Usp53 T C 3: 122,936,057 E756G probably damaging Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Ch25h
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0738:Ch25h UTSW 19 34474387 missense possibly damaging 0.90
R1711:Ch25h UTSW 19 34474286 missense probably benign
R2869:Ch25h UTSW 19 34474810 missense probably benign 0.03
R2873:Ch25h UTSW 19 34474810 missense probably benign 0.03
R5558:Ch25h UTSW 19 34474463 missense probably damaging 1.00
R6173:Ch25h UTSW 19 34474496 missense probably damaging 1.00
R8313:Ch25h UTSW 19 34474738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCAGATGTTAATCACGTGAAAG -3'
(R):5'- TTCTCGCCTTCCGTAAAGCAG -3'

Sequencing Primer
(F):5'- TGTTAATCACGTGAAAGGTAAAGATG -3'
(R):5'- GCCTTCCGTAAAGCAGCTTCTG -3'
Posted On2014-10-02