Incidental Mutation 'R0173:Intu'
ID 23698
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 038445-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0173 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 40629776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably null
Transcript: ENSMUST00000091186
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204176
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 100,148,286 (GRCm39) noncoding transcript Het
Akt1s1 C T 7: 44,502,284 (GRCm39) P95S possibly damaging Het
Ambra1 T C 2: 91,640,564 (GRCm39) probably benign Het
Aunip T A 4: 134,250,861 (GRCm39) W269R probably damaging Het
Bmper A G 9: 23,136,125 (GRCm39) M69V probably benign Het
Cdh2 A T 18: 16,783,314 (GRCm39) probably benign Het
Cenpe T C 3: 134,965,744 (GRCm39) M2074T probably benign Het
Col14a1 C T 15: 55,351,928 (GRCm39) P1592S probably damaging Het
Csgalnact1 G A 8: 68,913,681 (GRCm39) R175C probably damaging Het
Dtx1 A G 5: 120,820,818 (GRCm39) probably benign Het
Elmod3 T C 6: 72,554,571 (GRCm39) D154G probably damaging Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Gab1 T C 8: 81,526,789 (GRCm39) D103G possibly damaging Het
Gon4l A G 3: 88,765,710 (GRCm39) D377G probably damaging Het
Gramd1c C T 16: 43,818,196 (GRCm39) R328K possibly damaging Het
Hdac3 A G 18: 38,074,806 (GRCm39) S312P probably damaging Het
Hmcn2 T C 2: 31,328,343 (GRCm39) probably null Het
Lnpk T C 2: 74,381,409 (GRCm39) K118R probably damaging Het
Lzts3 A C 2: 130,476,688 (GRCm39) *587G probably null Het
Mctp2 C T 7: 71,896,855 (GRCm39) probably null Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Mmp23 G T 4: 155,735,222 (GRCm39) R374S possibly damaging Het
Morc3 G A 16: 93,629,094 (GRCm39) probably null Het
Mymk C T 2: 26,952,262 (GRCm39) A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Neb T C 2: 52,133,859 (GRCm39) S3375G probably damaging Het
Nedd1 T C 10: 92,534,745 (GRCm39) D255G probably benign Het
Nid2 T C 14: 19,852,400 (GRCm39) probably benign Het
Nr1d2 A G 14: 18,215,502 (GRCm38) probably benign Het
Nus1 A G 10: 52,294,094 (GRCm39) H86R possibly damaging Het
Or5b118 A T 19: 13,449,065 (GRCm39) I244F probably benign Het
Or7g17 A G 9: 18,768,325 (GRCm39) I135V probably damaging Het
Plcxd2 A T 16: 45,785,542 (GRCm39) probably null Het
Prdm9 T A 17: 15,764,275 (GRCm39) D835V probably benign Het
Prdm9 A G 17: 15,764,297 (GRCm39) W828R probably benign Het
Prkd2 T C 7: 16,582,969 (GRCm39) S244P probably benign Het
Psmd4 A T 3: 94,940,234 (GRCm39) L159H probably damaging Het
Qprt C T 7: 126,707,543 (GRCm39) G215E probably damaging Het
Rab3gap2 C A 1: 184,982,104 (GRCm39) H385Q possibly damaging Het
Rapgef5 A G 12: 117,652,411 (GRCm39) D300G probably benign Het
Rbl1 A T 2: 157,001,605 (GRCm39) N894K probably benign Het
Rgma C T 7: 73,067,302 (GRCm39) R280W probably damaging Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Rundc3a T A 11: 102,289,071 (GRCm39) probably benign Het
Scaf11 A T 15: 96,318,075 (GRCm39) D496E probably benign Het
Scn9a T C 2: 66,363,437 (GRCm39) Y936C probably damaging Het
Sdk1 A G 5: 142,159,564 (GRCm39) probably benign Het
Serpinb9 G A 13: 33,194,705 (GRCm39) D154N probably benign Het
Slc48a1 A T 15: 97,688,555 (GRCm39) H131L possibly damaging Het
Slco1a6 T C 6: 142,048,848 (GRCm39) N311D probably benign Het
Sorl1 A G 9: 41,979,229 (GRCm39) V423A probably damaging Het
Srrm2 C A 17: 24,034,103 (GRCm39) probably benign Het
Srsf12 A T 4: 33,226,117 (GRCm39) S122C probably damaging Het
Suclg2 G C 6: 95,452,154 (GRCm39) probably benign Het
Tbpl1 A T 10: 22,583,523 (GRCm39) L149* probably null Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Tmem63a T C 1: 180,782,363 (GRCm39) probably benign Het
Tut1 C T 19: 8,942,847 (GRCm39) R645* probably null Het
Ubqln4 T A 3: 88,462,686 (GRCm39) D50E probably benign Het
Ubr5 A G 15: 38,004,919 (GRCm39) S1227P probably damaging Het
Vipas39 A G 12: 87,297,285 (GRCm39) probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vps26b G A 9: 26,924,101 (GRCm39) T214I probably benign Het
Xpc A G 6: 91,481,717 (GRCm39) probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAGGCATAACTCTGTCCGTGATTG -3'
(R):5'- AATGATGTGGGACCATCCCAGACC -3'

Sequencing Primer
(F):5'- CTCTGACTAAAGCTGAGGCTG -3'
(R):5'- GGACCATCCCAGACCTATAGC -3'
Posted On 2013-04-16