Incidental Mutation 'R2178:Clca1'
ID236983
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Namechloride channel accessory 1
Synonymsgob-5, gob5, Clca3
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145003817-145032776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145006102 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 711 (N711D)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: N711D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: N711D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Gm13089 A T 4: 143,698,042 I277K possibly damaging Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Prkar2a T C 9: 108,740,538 probably null Het
Qrich2 T C 11: 116,443,777 D2194G probably damaging Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Tgfb1 A G 7: 25,704,809 N347S probably damaging Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tjp3 T C 10: 81,280,107 E313G probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5044:Clca1 UTSW 3 145007928 splice site probably null
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6729:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7106:Clca1 UTSW 3 145027429 missense probably damaging 0.98
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7212:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7446:Clca1 UTSW 3 145027427 missense possibly damaging 0.65
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGATTCACCAGGTTCTGCC -3'
(R):5'- ACGCCTGTCAGGTAAAGAC -3'

Sequencing Primer
(F):5'- ACCAGGTTCTGCCCTTGGATG -3'
(R):5'- ATTGTCTTCTGATACAACCCGATTTG -3'
Posted On2014-10-02