Incidental Mutation 'R2178:Gm13089'
ID236989
Institutional Source Beutler Lab
Gene Symbol Gm13089
Ensembl Gene ENSMUSG00000070617
Gene Namepredicted gene 13089
Synonyms
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143696500-143702711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143698042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 277 (I277K)
Ref Sequence ENSEMBL: ENSMUSP00000073224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073532
AA Change: I277K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073224
Gene: ENSMUSG00000070617
AA Change: I277K

DomainStartEndE-ValueType
low complexity region 204 216 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Clca1 T C 3: 145,006,102 N711D probably damaging Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Prkar2a T C 9: 108,740,538 probably null Het
Qrich2 T C 11: 116,443,777 D2194G probably damaging Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Tgfb1 A G 7: 25,704,809 N347S probably damaging Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tjp3 T C 10: 81,280,107 E313G probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Gm13089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm13089 APN 4 143696840 utr 3 prime probably benign
IGL02087:Gm13089 APN 4 143697074 missense probably damaging 0.96
IGL02296:Gm13089 APN 4 143698481 nonsense probably null
IGL02902:Gm13089 APN 4 143698343 missense probably damaging 1.00
IGL02903:Gm13089 APN 4 143699166 missense probably benign 0.04
IGL02962:Gm13089 APN 4 143697340 missense probably benign 0.28
IGL03351:Gm13089 APN 4 143697088 missense possibly damaging 0.80
R0122:Gm13089 UTSW 4 143698404 missense probably benign 0.44
R0533:Gm13089 UTSW 4 143698020 nonsense probably null
R0609:Gm13089 UTSW 4 143698503 missense probably benign 0.00
R0743:Gm13089 UTSW 4 143698564 missense probably damaging 0.97
R0744:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R0833:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R1052:Gm13089 UTSW 4 143696907 missense possibly damaging 0.81
R1690:Gm13089 UTSW 4 143698123 missense probably benign 0.03
R1764:Gm13089 UTSW 4 143698270 missense probably benign 0.14
R1896:Gm13089 UTSW 4 143698144 missense probably benign 0.11
R2084:Gm13089 UTSW 4 143699350 missense probably damaging 1.00
R2888:Gm13089 UTSW 4 143696890 missense probably benign 0.00
R3759:Gm13089 UTSW 4 143697151 missense probably damaging 1.00
R4193:Gm13089 UTSW 4 143698333 missense probably damaging 1.00
R4380:Gm13089 UTSW 4 143698286 missense probably benign 0.21
R4385:Gm13089 UTSW 4 143698014 critical splice donor site probably null
R4513:Gm13089 UTSW 4 143698148 missense probably benign 0.00
R4647:Gm13089 UTSW 4 143699344 missense probably benign 0.00
R4920:Gm13089 UTSW 4 143699283 missense probably benign 0.05
R4994:Gm13089 UTSW 4 143698369 missense possibly damaging 0.94
R5197:Gm13089 UTSW 4 143698062 missense possibly damaging 0.86
R6005:Gm13089 UTSW 4 143698432 missense probably benign 0.00
R6073:Gm13089 UTSW 4 143698268 missense probably damaging 0.99
R6197:Gm13089 UTSW 4 143697316 missense possibly damaging 0.90
R6264:Gm13089 UTSW 4 143699152 missense possibly damaging 0.50
R6821:Gm13089 UTSW 4 143699304 nonsense probably null
R6923:Gm13089 UTSW 4 143699106 missense probably benign 0.06
R7034:Gm13089 UTSW 4 143697328 missense probably damaging 1.00
R7140:Gm13089 UTSW 4 143698432 missense probably benign 0.01
R7298:Gm13089 UTSW 4 143698505 missense probably benign 0.23
R7529:Gm13089 UTSW 4 143702674
R7766:Gm13089 UTSW 4 143699239 missense probably damaging 0.98
R7774:Gm13089 UTSW 4 143697106 missense possibly damaging 0.89
R7816:Gm13089 UTSW 4 143698194 missense probably benign 0.00
R8137:Gm13089 UTSW 4 143699265 missense probably damaging 1.00
Z1088:Gm13089 UTSW 4 143698080 missense probably benign
Z1176:Gm13089 UTSW 4 143696945 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACCATCATGGACTCCCTAG -3'
(R):5'- TGCAGACTGTATACAAGAGCTG -3'

Sequencing Primer
(F):5'- ATGGACTCCCTAGCGTCC -3'
(R):5'- GCCTGGAAGATTTGGATTTTCTTAAC -3'
Posted On2014-10-02