Incidental Mutation 'R2178:Tgfb1'
ID236997
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Nametransforming growth factor, beta 1
SynonymsTgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25687002-25705077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25704809 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 347 (N347S)
Ref Sequence ENSEMBL: ENSMUSP00000002678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678]
Predicted Effect probably damaging
Transcript: ENSMUST00000002678
AA Change: N347S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603
AA Change: N347S

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Clca1 T C 3: 145,006,102 N711D probably damaging Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Gm13089 A T 4: 143,698,042 I277K possibly damaging Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Prkar2a T C 9: 108,740,538 probably null Het
Qrich2 T C 11: 116,443,777 D2194G probably damaging Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tjp3 T C 10: 81,280,107 E313G probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25688017 missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25704196 missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25696918 missense probably benign
R0004:Tgfb1 UTSW 7 25692366 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0470:Tgfb1 UTSW 7 25687930 unclassified probably benign
R1872:Tgfb1 UTSW 7 25692466 missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25697230 missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25688149 missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25694281 missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25696960 missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25696925 missense probably benign 0.01
R6727:Tgfb1 UTSW 7 25689162 unclassified probably benign
R7203:Tgfb1 UTSW 7 25692539 critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25704838 missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25687695 unclassified probably benign
Z1177:Tgfb1 UTSW 7 25688208 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGAGAGCTAGTGATGT -3'
(R):5'- CTGTCACCTTTAATGGGCCC -3'

Sequencing Primer
(F):5'- GCTAGTGATGTGGAGAGATACAG -3'
(R):5'- GTGCAGGTGTCCTTAAATACAGCC -3'
Posted On2014-10-02