Mutagenetix > Incidental Mutation

Incidental Mutation 'R2178:Ticrr'

236999

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

040180-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R2178 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79665685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 229 (V229A)

Ref Sequence

ENSEMBL: ENSMUSP00000146155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

probably benign
Transcript: ENSMUST00000035977
AA Change: V229A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V229A

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205750

Predicted Effect

probably benign
Transcript: ENSMUST00000206017
AA Change: V229A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206072

Predicted Effect

probably benign
Transcript: ENSMUST00000206591
AA Change: V229A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000206622
AA Change: V229A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	A	T	15: 98,594,355	N1007K	probably damaging	Het
Apon	C	A	10: 128,254,765	A104E	probably benign	Het
Cdh15	T	A	8: 122,864,976		probably null	Het
Cep135	T	C	5: 76,631,450	V769A	probably benign	Het
Cep152	A	T	2: 125,580,034		probably null	Het
Clca1	T	C	3: 145,006,102	N711D	probably damaging	Het
Col1a2	T	C	6: 4,531,143	F731L	unknown	Het
Cpt1b	T	C	15: 89,419,043	E603G	probably damaging	Het
Cspp1	T	G	1: 10,104,246	D641E	possibly damaging	Het
Ddr2	C	T	1: 169,994,682	R399Q	probably benign	Het
Dzip1	T	C	14: 118,889,404		probably null	Het
Gm13089	A	T	4: 143,698,042	I277K	possibly damaging	Het
Greb1	A	G	12: 16,696,387	V1294A	probably damaging	Het
Hmgb4	A	G	4: 128,260,482	S98P	probably damaging	Het
Kif12	G	A	4: 63,166,959	P515L	probably benign	Het
Kmt5b	A	C	19: 3,815,372	E789A	possibly damaging	Het
Lama1	G	T	17: 67,769,515	V1095F	probably benign	Het
Leprot	T	C	4: 101,656,111	V32A	probably benign	Het
Mcoln1	A	G	8: 3,508,766	T255A	probably damaging	Het
Mertk	G	A	2: 128,793,064	E765K	probably damaging	Het
Muc5b	A	G	7: 141,864,116	T3600A	possibly damaging	Het
Ncapd3	A	T	9: 27,088,549	E1395V	probably benign	Het
Ntrk2	T	C	13: 58,808,802	F25S	probably benign	Het
Olfr1348	G	T	7: 6,501,488	A246D	probably damaging	Het
Olfr1356	T	A	10: 78,847,778	I46F	probably damaging	Het
Olfr448	A	G	6: 42,896,798	M116V	probably benign	Het
Pappa	C	A	4: 65,351,687	H1613N	probably benign	Het
Polq	T	C	16: 37,062,829	V1785A	probably damaging	Het
Prkar2a	T	C	9: 108,740,538		probably null	Het
Qrich2	T	C	11: 116,443,777	D2194G	probably damaging	Het
Rnf183	T	C	4: 62,428,096	N155S	probably benign	Het
S1pr5	T	C	9: 21,244,464	N222S	probably benign	Het
Scnn1a	C	T	6: 125,331,002	R170C	probably damaging	Het
Slc25a2	T	C	18: 37,638,258	T73A	probably benign	Het
Tgfb1	A	G	7: 25,704,809	N347S	probably damaging	Het
Tjp3	T	C	10: 81,280,107	E313G	probably benign	Het
Tnfsf11	A	G	14: 78,284,242	S176P	probably benign	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vps39	C	A	2: 120,323,679	E612*	probably null	Het
Vwf	T	A	6: 125,642,132	Y1258N	possibly damaging	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AGCTATGTAGTAATGGATACTAGGTG -3'
(R):5'- AATTCGTGGAAATGAGGCTTCATAC -3'

Sequencing Primer
(F):5'- TGTTATTTGTACTTAGGTCAACAGG -3'
(R):5'- GCAAACAGTTTACAGTGGCATC -3'

Posted On

2014-10-02