Incidental Mutation 'R2178:Prkar2a'
ID 237008
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Name protein kinase, cAMP dependent regulatory, type II alpha
Synonyms 1110061A24Rik, RII(alpha)
MMRRC Submission 040180-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2178 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108569342-108627643 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108617737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000195405]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000035220
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083740
Predicted Effect probably null
Transcript: ENSMUST00000192068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193215
Predicted Effect probably null
Transcript: ENSMUST00000195405
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,492,236 (GRCm39) N1007K probably damaging Het
Apon C A 10: 128,090,634 (GRCm39) A104E probably benign Het
Cdh15 T A 8: 123,591,715 (GRCm39) probably null Het
Cep135 T C 5: 76,779,297 (GRCm39) V769A probably benign Het
Cep152 A T 2: 125,421,954 (GRCm39) probably null Het
Clca3a1 T C 3: 144,711,863 (GRCm39) N711D probably damaging Het
Col1a2 T C 6: 4,531,143 (GRCm39) F731L unknown Het
Cpt1b T C 15: 89,303,246 (GRCm39) E603G probably damaging Het
Cspp1 T G 1: 10,174,471 (GRCm39) D641E possibly damaging Het
Ddr2 C T 1: 169,822,251 (GRCm39) R399Q probably benign Het
Dzip1 T C 14: 119,126,816 (GRCm39) probably null Het
Greb1 A G 12: 16,746,388 (GRCm39) V1294A probably damaging Het
Hmgb4 A G 4: 128,154,275 (GRCm39) S98P probably damaging Het
Kif12 G A 4: 63,085,196 (GRCm39) P515L probably benign Het
Kmt5b A C 19: 3,865,372 (GRCm39) E789A possibly damaging Het
Lama1 G T 17: 68,076,510 (GRCm39) V1095F probably benign Het
Leprot T C 4: 101,513,308 (GRCm39) V32A probably benign Het
Mcoln1 A G 8: 3,558,766 (GRCm39) T255A probably damaging Het
Mertk G A 2: 128,634,984 (GRCm39) E765K probably damaging Het
Muc5b A G 7: 141,417,853 (GRCm39) T3600A possibly damaging Het
Ncapd3 A T 9: 26,999,845 (GRCm39) E1395V probably benign Het
Ntrk2 T C 13: 58,956,616 (GRCm39) F25S probably benign Het
Or2a5 A G 6: 42,873,732 (GRCm39) M116V probably benign Het
Or6z1 G T 7: 6,504,487 (GRCm39) A246D probably damaging Het
Or7c70 T A 10: 78,683,612 (GRCm39) I46F probably damaging Het
Pappa C A 4: 65,269,924 (GRCm39) H1613N probably benign Het
Polq T C 16: 36,883,191 (GRCm39) V1785A probably damaging Het
Pramel23 A T 4: 143,424,612 (GRCm39) I277K possibly damaging Het
Qrich2 T C 11: 116,334,603 (GRCm39) D2194G probably damaging Het
Rnf183 T C 4: 62,346,333 (GRCm39) N155S probably benign Het
S1pr5 T C 9: 21,155,760 (GRCm39) N222S probably benign Het
Scnn1a C T 6: 125,307,965 (GRCm39) R170C probably damaging Het
Slc25a2 T C 18: 37,771,311 (GRCm39) T73A probably benign Het
Tgfb1 A G 7: 25,404,234 (GRCm39) N347S probably damaging Het
Ticrr T C 7: 79,315,433 (GRCm39) V229A probably benign Het
Tjp3 T C 10: 81,115,941 (GRCm39) E313G probably benign Het
Tnfsf11 A G 14: 78,521,682 (GRCm39) S176P probably benign Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vps39 C A 2: 120,154,160 (GRCm39) E612* probably null Het
Vwf T A 6: 125,619,095 (GRCm39) Y1258N possibly damaging Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108,610,403 (GRCm39) missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108,610,322 (GRCm39) missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108,596,460 (GRCm39) missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108,624,152 (GRCm39) missense probably benign 0.04
IGL02635:Prkar2a APN 9 108,605,476 (GRCm39) missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108,617,640 (GRCm39) missense probably benign
PIT4486001:Prkar2a UTSW 9 108,610,326 (GRCm39) missense probably damaging 1.00
R0335:Prkar2a UTSW 9 108,596,457 (GRCm39) missense probably damaging 1.00
R0920:Prkar2a UTSW 9 108,596,496 (GRCm39) splice site probably benign
R0943:Prkar2a UTSW 9 108,610,475 (GRCm39) splice site probably benign
R1513:Prkar2a UTSW 9 108,605,469 (GRCm39) missense possibly damaging 0.82
R3820:Prkar2a UTSW 9 108,624,155 (GRCm39) missense probably damaging 1.00
R3842:Prkar2a UTSW 9 108,605,467 (GRCm39) missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108,617,584 (GRCm39) intron probably benign
R4886:Prkar2a UTSW 9 108,622,823 (GRCm39) critical splice donor site probably null
R5051:Prkar2a UTSW 9 108,622,690 (GRCm39) missense probably benign 0.00
R5435:Prkar2a UTSW 9 108,617,682 (GRCm39) missense probably damaging 1.00
R6979:Prkar2a UTSW 9 108,610,342 (GRCm39) missense possibly damaging 0.76
R7121:Prkar2a UTSW 9 108,569,821 (GRCm39) missense probably benign
R7199:Prkar2a UTSW 9 108,617,669 (GRCm39) missense probably damaging 1.00
R7819:Prkar2a UTSW 9 108,622,744 (GRCm39) missense probably damaging 1.00
R8194:Prkar2a UTSW 9 108,569,710 (GRCm39) missense probably damaging 1.00
R8218:Prkar2a UTSW 9 108,596,448 (GRCm39) missense possibly damaging 0.83
R8253:Prkar2a UTSW 9 108,617,638 (GRCm39) missense probably damaging 1.00
X0060:Prkar2a UTSW 9 108,622,781 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGATACAGTGACTTCCAGCTC -3'
(R):5'- CGACTCACCTGTGCGATTATTC -3'

Sequencing Primer
(F):5'- GATACAGTGACTTCCAGCTCTCTAG -3'
(R):5'- GATCACATCCACAATCTTCATTCG -3'
Posted On 2014-10-02