Incidental Mutation 'R2178:Prkar2a'
ID237008
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Nameprotein kinase, cAMP dependent regulatory, type II alpha
Synonyms1110061A24Rik, RII(alpha)
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108689314-108750436 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108740538 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000195405]
Predicted Effect probably null
Transcript: ENSMUST00000035220
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083740
Predicted Effect probably null
Transcript: ENSMUST00000192068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193215
Predicted Effect probably null
Transcript: ENSMUST00000195405
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Clca1 T C 3: 145,006,102 N711D probably damaging Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Gm13089 A T 4: 143,698,042 I277K possibly damaging Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Qrich2 T C 11: 116,443,777 D2194G probably damaging Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Tgfb1 A G 7: 25,704,809 N347S probably damaging Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tjp3 T C 10: 81,280,107 E313G probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108733204 missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108733123 missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108719261 missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108746953 missense probably benign 0.04
IGL02635:Prkar2a APN 9 108728277 missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108740441 missense probably benign
PIT4486001:Prkar2a UTSW 9 108733127 missense probably damaging 1.00
R0335:Prkar2a UTSW 9 108719258 missense probably damaging 1.00
R0920:Prkar2a UTSW 9 108719297 splice site probably benign
R0943:Prkar2a UTSW 9 108733276 splice site probably benign
R1513:Prkar2a UTSW 9 108728270 missense possibly damaging 0.82
R3820:Prkar2a UTSW 9 108746956 missense probably damaging 1.00
R3842:Prkar2a UTSW 9 108728268 missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108740385 intron probably benign
R4886:Prkar2a UTSW 9 108745624 critical splice donor site probably null
R5051:Prkar2a UTSW 9 108745491 missense probably benign 0.00
R5435:Prkar2a UTSW 9 108740483 missense probably damaging 1.00
R6979:Prkar2a UTSW 9 108733143 missense possibly damaging 0.76
R7121:Prkar2a UTSW 9 108692622 missense probably benign
R7199:Prkar2a UTSW 9 108740470 missense probably damaging 1.00
R7819:Prkar2a UTSW 9 108745545 missense probably damaging 1.00
R8194:Prkar2a UTSW 9 108692511 missense probably damaging 1.00
R8218:Prkar2a UTSW 9 108719249 missense possibly damaging 0.83
R8253:Prkar2a UTSW 9 108740439 missense probably damaging 1.00
X0060:Prkar2a UTSW 9 108745582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGATACAGTGACTTCCAGCTC -3'
(R):5'- CGACTCACCTGTGCGATTATTC -3'

Sequencing Primer
(F):5'- GATACAGTGACTTCCAGCTCTCTAG -3'
(R):5'- GATCACATCCACAATCTTCATTCG -3'
Posted On2014-10-02