Incidental Mutation 'R2178:Tjp3'
ID237010
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Nametight junction protein 3
SynonymsZO-3
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81273207-81291581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81280107 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000151601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000218484] [ENSMUST00000219479]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
AA Change: E313G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: E313G

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218966
Predicted Effect probably benign
Transcript: ENSMUST00000219479
AA Change: E313G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219958
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Clca1 T C 3: 145,006,102 N711D probably damaging Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Gm13089 A T 4: 143,698,042 I277K possibly damaging Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Prkar2a T C 9: 108,740,538 probably null Het
Qrich2 T C 11: 116,443,777 D2194G probably damaging Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Tgfb1 A G 7: 25,704,809 N347S probably damaging Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81273865 missense probably benign
IGL01739:Tjp3 APN 10 81278656 missense probably benign 0.09
IGL02826:Tjp3 APN 10 81273689 missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81283688 missense probably benign 0.05
PIT4480001:Tjp3 UTSW 10 81279257 missense probably damaging 1.00
R0561:Tjp3 UTSW 10 81273840 missense probably benign
R0562:Tjp3 UTSW 10 81280555 missense probably damaging 0.99
R1099:Tjp3 UTSW 10 81273823 missense probably benign
R1618:Tjp3 UTSW 10 81276260 unclassified probably benign
R1786:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R1955:Tjp3 UTSW 10 81277999 missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81280544 missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R3054:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R3055:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R5470:Tjp3 UTSW 10 81279547 missense probably benign 0.04
R5645:Tjp3 UTSW 10 81278620 splice site probably null
R5918:Tjp3 UTSW 10 81277912 missense probably benign 0.01
R6108:Tjp3 UTSW 10 81281146 missense probably benign
R6245:Tjp3 UTSW 10 81277276 missense probably benign 0.02
R6300:Tjp3 UTSW 10 81281117 nonsense probably null
R7686:Tjp3 UTSW 10 81278051 missense probably benign 0.00
R7958:Tjp3 UTSW 10 81282994 missense possibly damaging 0.56
R8137:Tjp3 UTSW 10 81273691 missense probably benign 0.00
R8240:Tjp3 UTSW 10 81273807 missense probably benign 0.06
R8317:Tjp3 UTSW 10 81280490 missense probably benign 0.11
Z1176:Tjp3 UTSW 10 81281109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATTCACTGACCGTTCCC -3'
(R):5'- TTCTGTGAGATTCGGAGGACCC -3'

Sequencing Primer
(F):5'- ACTGACCGTTCCCGCCTC -3'
(R):5'- AGATTCGGAGGACCCCTAGCTC -3'
Posted On2014-10-02