Incidental Mutation 'R2178:Qrich2'
ID237013
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
MMRRC Submission 040180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2178 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116443777 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2194 (D2194G)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057676] [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000057676
SMART Domains Protein: ENSMUSP00000058894
Gene: ENSMUSG00000050628

DomainStartEndE-ValueType
Pfam:UBA_4 11 53 1.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093909
AA Change: D449G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331
AA Change: D449G

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140697
Predicted Effect probably damaging
Transcript: ENSMUST00000208602
AA Change: D2194G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,594,355 N1007K probably damaging Het
Apon C A 10: 128,254,765 A104E probably benign Het
Cdh15 T A 8: 122,864,976 probably null Het
Cep135 T C 5: 76,631,450 V769A probably benign Het
Cep152 A T 2: 125,580,034 probably null Het
Clca1 T C 3: 145,006,102 N711D probably damaging Het
Col1a2 T C 6: 4,531,143 F731L unknown Het
Cpt1b T C 15: 89,419,043 E603G probably damaging Het
Cspp1 T G 1: 10,104,246 D641E possibly damaging Het
Ddr2 C T 1: 169,994,682 R399Q probably benign Het
Dzip1 T C 14: 118,889,404 probably null Het
Gm13089 A T 4: 143,698,042 I277K possibly damaging Het
Greb1 A G 12: 16,696,387 V1294A probably damaging Het
Hmgb4 A G 4: 128,260,482 S98P probably damaging Het
Kif12 G A 4: 63,166,959 P515L probably benign Het
Kmt5b A C 19: 3,815,372 E789A possibly damaging Het
Lama1 G T 17: 67,769,515 V1095F probably benign Het
Leprot T C 4: 101,656,111 V32A probably benign Het
Mcoln1 A G 8: 3,508,766 T255A probably damaging Het
Mertk G A 2: 128,793,064 E765K probably damaging Het
Muc5b A G 7: 141,864,116 T3600A possibly damaging Het
Ncapd3 A T 9: 27,088,549 E1395V probably benign Het
Ntrk2 T C 13: 58,808,802 F25S probably benign Het
Olfr1348 G T 7: 6,501,488 A246D probably damaging Het
Olfr1356 T A 10: 78,847,778 I46F probably damaging Het
Olfr448 A G 6: 42,896,798 M116V probably benign Het
Pappa C A 4: 65,351,687 H1613N probably benign Het
Polq T C 16: 37,062,829 V1785A probably damaging Het
Prkar2a T C 9: 108,740,538 probably null Het
Rnf183 T C 4: 62,428,096 N155S probably benign Het
S1pr5 T C 9: 21,244,464 N222S probably benign Het
Scnn1a C T 6: 125,331,002 R170C probably damaging Het
Slc25a2 T C 18: 37,638,258 T73A probably benign Het
Tgfb1 A G 7: 25,704,809 N347S probably damaging Het
Ticrr T C 7: 79,665,685 V229A probably benign Het
Tjp3 T C 10: 81,280,107 E313G probably benign Het
Tnfsf11 A G 14: 78,284,242 S176P probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps39 C A 2: 120,323,679 E612* probably null Het
Vwf T A 6: 125,642,132 Y1258N possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7916:Qrich2 UTSW 11 116455765 missense probably benign 0.04
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCTCTCCACTAGAAAGCAGC -3'
(R):5'- TCAGACCAGACTCCATGCAG -3'

Sequencing Primer
(F):5'- CCACTTGGCTTCAGGAGGAG -3'
(R):5'- ATATATCTCCCAGACTGGCCTTGAAG -3'
Posted On2014-10-02