Incidental Mutation 'R2179:Irs1'
ID237029
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82290219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 92 (H92L)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069799
AA Change: H92L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: H92L

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7991:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7993:Irs1 UTSW 1 82289884 missense probably benign
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense not run
Z1177:Irs1 UTSW 1 82290394 missense not run
Predicted Primers PCR Primer
(F):5'- ATAACCTGCCAGACCTCCTTG -3'
(R):5'- CCCAAGAGTATGCATAAGCGC -3'

Sequencing Primer
(F):5'- TCCTGGACCCGTGTCATAG -3'
(R):5'- CCAAGAGTATGCATAAGCGCTTTTTC -3'
Posted On2014-10-02