Incidental Mutation 'R2179:Lrba'
ID237038
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86354281 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1514 (L1514R)
Ref Sequence ENSEMBL: ENSMUSP00000148618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: L1514R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: L1514R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192145
AA Change: L1514R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: L1514R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194759
AA Change: L1514R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: L1514R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195966
Predicted Effect probably damaging
Transcript: ENSMUST00000212390
AA Change: L1514R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 intron probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7243:Lrba UTSW 3 86751516 splice site probably null
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
R7492:Lrba UTSW 3 86664528 missense probably damaging 1.00
R7651:Lrba UTSW 3 86741466 nonsense probably null
R7729:Lrba UTSW 3 86318167 missense probably damaging 1.00
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATATTCAGCTCCTGCAAG -3'
(R):5'- GGTCAGTTCCAAGAAACCTGGC -3'

Sequencing Primer
(F):5'- CTCCTGCAAGGAAAGGAGACTTATG -3'
(R):5'- GTTCCAAGAAACCTGGCTTCGAG -3'
Posted On2014-10-02