Incidental Mutation 'R2179:Paics'
ID237042
Institutional Source Beutler Lab
Gene Symbol Paics
Ensembl Gene ENSMUSG00000029247
Gene Namephosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase
SynonymsADE2H1, 2610511I09Rik, PAIS, AIRC
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76951307-76967509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76961444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 209 (I209F)
Ref Sequence ENSEMBL: ENSMUSP00000113483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031160] [ENSMUST00000117536] [ENSMUST00000120912] [ENSMUST00000141687] [ENSMUST00000153648]
Predicted Effect probably damaging
Transcript: ENSMUST00000031160
AA Change: I209F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031160
Gene: ENSMUSG00000029247
AA Change: I209F

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 253 4.8e-81 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117536
AA Change: I209F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112879
Gene: ENSMUSG00000029247
AA Change: I209F

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 253 4.8e-81 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120912
AA Change: I209F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113483
Gene: ENSMUSG00000029247
AA Change: I209F

DomainStartEndE-ValueType
Pfam:SAICAR_synt 11 248 4e-56 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140051
Predicted Effect probably benign
Transcript: ENSMUST00000141687
SMART Domains Protein: ENSMUSP00000117027
Gene: ENSMUSG00000029247

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 83 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153648
SMART Domains Protein: ENSMUSP00000123558
Gene: ENSMUSG00000029247

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 94 9.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154688
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme containing phosphoribosylaminoimidazole carboxylase activity in its N-terminal region and phosphoribosylaminoimidazole succinocarboxamide synthetase in its C-terminal region. It catalyzes steps 6 and 7 of purine biosynthesis. The gene is closely linked and divergently transcribed with a locus that encodes an enzyme in the same pathway, and transcription of the two genes is coordinately regulated. The human genome contains several pseudogenes of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Paics
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Paics APN 5 76956731 missense probably damaging 1.00
IGL01642:Paics APN 5 76961510 splice site probably benign
IGL01689:Paics APN 5 76961291 critical splice donor site probably null
IGL02559:Paics APN 5 76964604 missense possibly damaging 0.55
IGL02814:Paics APN 5 76962473 missense probably damaging 0.99
IGL03093:Paics APN 5 76961508 critical splice donor site probably null
IGL02980:Paics UTSW 5 76966255 missense probably benign 0.00
LCD18:Paics UTSW 5 76956744 frame shift probably null
R4573:Paics UTSW 5 76956603 missense probably benign 0.09
R4926:Paics UTSW 5 76961204 missense probably damaging 1.00
R5134:Paics UTSW 5 76956822 intron probably benign
R5308:Paics UTSW 5 76956632 missense probably damaging 1.00
R7996:Paics UTSW 5 76959429 missense probably benign 0.11
R8300:Paics UTSW 5 76961406 missense probably damaging 1.00
R8506:Paics UTSW 5 76964590 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACTGTACGCTGGTTGATATGAAG -3'
(R):5'- CCATTGGGTTGTATCTCCAGC -3'

Sequencing Primer
(F):5'- CATTTCCTTGGCAATGTGC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2014-10-02