Incidental Mutation 'R0173:Mmp23'
ID23705
Institutional Source Beutler Lab
Gene Symbol Mmp23
Ensembl Gene ENSMUSG00000029061
Gene Namematrix metallopeptidase 23
SynonymsCA-MMP, cysteine array matrix metalloproteinase
MMRRC Submission 038445-MU
Accession Numbers

Ncbi RefSeq: NM_011985.2; MGI:1347361

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location155650655-155653384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155650765 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 374 (R374S)
Ref Sequence ENSEMBL: ENSMUSP00000030937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000103176] [ENSMUST00000105598] [ENSMUST00000105600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030937
AA Change: R374S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061
AA Change: R374S

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067081
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103176
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105598
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105600
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155100
Meta Mutation Damage Score 0.1259 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein contains an N-terminal cysteine array and a novel immunoglobulin-fold domain at the C-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Mmp23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Mmp23 APN 4 155651007 missense possibly damaging 0.67
IGL02749:Mmp23 APN 4 155651532 missense possibly damaging 0.65
R0030:Mmp23 UTSW 4 155651311 nonsense probably null
R0244:Mmp23 UTSW 4 155652132 missense probably damaging 1.00
R1521:Mmp23 UTSW 4 155650717 missense possibly damaging 0.92
R1696:Mmp23 UTSW 4 155650709 makesense probably null
R1957:Mmp23 UTSW 4 155652052 missense possibly damaging 0.96
R2055:Mmp23 UTSW 4 155651987 missense possibly damaging 0.76
R3946:Mmp23 UTSW 4 155652023 missense probably damaging 1.00
R4170:Mmp23 UTSW 4 155651310 missense probably damaging 0.99
R5153:Mmp23 UTSW 4 155651340 missense probably damaging 1.00
R5660:Mmp23 UTSW 4 155651253 missense probably damaging 1.00
R6193:Mmp23 UTSW 4 155651533 missense possibly damaging 0.90
R6480:Mmp23 UTSW 4 155652341 missense probably damaging 1.00
R7426:Mmp23 UTSW 4 155651584 missense probably damaging 1.00
R7979:Mmp23 UTSW 4 155652005 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACATTCAGATGGGCAGAGACTGGC -3'
(R):5'- GGAACATGACCTTCCACTGTGGAC -3'

Sequencing Primer
(F):5'- AGAGACTGGCCTTCCCTC -3'
(R):5'- TTCCACTGTGGACAGAAGATCC -3'
Posted On2013-04-16