Incidental Mutation 'R2179:Igf1r'
ID237051
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68003950 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 79 (T79A)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: T79A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: T79A

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACCATATGCCCCGCTTTG -3'
(R):5'- CGCATCCAAGATGAGAGACCAG -3'

Sequencing Primer
(F):5'- ATATGCCCCGCTTTGCCCTC -3'
(R):5'- AACAGAGGTCGGCGTTCTTCTC -3'
Posted On2014-10-02