Mutagenetix > Incidental Mutation

Incidental Mutation 'R2179:Il16'

237052

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

040181-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R2179 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to T at 83688079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000001792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]

AlphaFold

O54824

Predicted Effect

probably null
Transcript: ENSMUST00000001792

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153560

SMART Domains

Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	C	10: 10,395,274	D849G	possibly damaging	Het
Amz2	A	G	11: 109,429,832	H155R	probably damaging	Het
BC027072	T	C	17: 71,752,526	D52G	probably damaging	Het
Chuk	C	A	19: 44,103,721	C46F	possibly damaging	Het
Cp	A	T	3: 19,987,987	D973V	probably damaging	Het
Cpm	T	A	10: 117,683,361	D391E	probably benign	Het
Creb3	T	C	4: 43,566,306	S271P	probably damaging	Het
Cubn	T	A	2: 13,318,242	H2838L	possibly damaging	Het
Dennd2d	A	G	3: 106,492,460	H233R	probably benign	Het
Dnaaf2	C	A	12: 69,198,297		probably benign	Het
Enpp3	T	A	10: 24,805,895	Q304H	probably benign	Het
Fermt3	C	A	19: 7,014,414	R143L	probably benign	Het
Fndc8	A	C	11: 82,898,754	K246T	probably damaging	Het
Gaa	A	G	11: 119,275,058		probably null	Het
Gm4788	G	T	1: 139,731,541	P679Q	probably damaging	Het
Gucy2e	A	T	11: 69,228,578		probably null	Het
Igf1r	A	G	7: 68,003,950	T79A	probably damaging	Het
Ikbkb	C	T	8: 22,681,753		probably null	Het
Irs1	T	A	1: 82,290,219	H92L	possibly damaging	Het
Itpr2	A	G	6: 146,375,966	M315T	probably benign	Het
Lrba	T	G	3: 86,354,281	L1514R	probably damaging	Het
Mcpt2	A	G	14: 56,042,116		probably benign	Het
Metap1d	A	G	2: 71,453,371	I5V	probably benign	Het
Mga	T	A	2: 119,960,442	S2479T	probably damaging	Het
Mllt10	T	C	2: 18,210,793	V1063A	probably damaging	Het
Mroh2b	G	A	15: 4,921,446		probably null	Het
Mtfr1	C	T	3: 19,200,144	R15*	probably null	Het
Npm2	A	G	14: 70,648,309	V152A	probably benign	Het
Nrxn3	T	A	12: 89,254,678	V409D	probably damaging	Het
Ogdhl	A	G	14: 32,335,345	N303D	probably damaging	Het
Olfr1423	T	C	19: 12,036,088	Y218C	probably damaging	Het
Olfr1491	T	C	19: 13,705,394	V189A	probably damaging	Het
Olfr750	A	G	14: 51,070,781	V204A	probably benign	Het
Olfr979	T	C	9: 40,000,924	Y101C	probably benign	Het
Pah	T	C	10: 87,567,335	F191L	probably damaging	Het
Paics	A	T	5: 76,961,444	I209F	probably damaging	Het
Pld6	A	G	11: 59,787,358	L93P	probably damaging	Het
Plod3	T	C	5: 136,991,008	F431L	possibly damaging	Het
Ppm1b	T	A	17: 84,994,434	D247E	probably damaging	Het
Prx	A	G	7: 27,517,985	D637G	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,909		probably benign	Het
Ryr2	A	T	13: 11,705,793	Y2656*	probably null	Het
Setd2	T	A	9: 110,594,688	Y492*	probably null	Het
Shmt1	A	G	11: 60,806,999	W9R	possibly damaging	Het
Slc25a17	A	G	15: 81,337,950	V107A	probably benign	Het
Sptlc1	A	T	13: 53,351,639	Y248N	probably damaging	Het
Stam2	T	C	2: 52,694,924	T453A	probably benign	Het
Tango2	G	T	16: 18,310,898	N77K	probably damaging	Het
Tas2r121	A	T	6: 132,700,868	I47N	probably damaging	Het
Terb1	A	T	8: 104,452,715	C614S	probably damaging	Het
Terb1	T	C	8: 104,472,737	N525S	probably benign	Het
Ttc6	A	G	12: 57,673,118	D825G	possibly damaging	Het
U90926	A	T	5: 92,209,979	H104Q	probably benign	Het
Zfand4	G	A	6: 116,314,781	A559T	possibly damaging	Het
Zfp462	T	C	4: 55,009,524	S497P	possibly damaging	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCTAGTTCTGATATTCAGGAGCAG -3'
(R):5'- TTCTCTGGTCCATGCCAACAG -3'

Sequencing Primer
(F):5'- AATCCATAGGTCTCCAGGTGATG -3'
(R):5'- GCCCATTAAGCTAAGCATACTTGTC -3'

Posted On

2014-10-02