Incidental Mutation 'R2179:Setd2'
ID237059
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 110594688 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 492 (Y492*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838]
Predicted Effect probably null
Transcript: ENSMUST00000153838
AA Change: Y2270*
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: Y2270*

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000197655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198697
Predicted Effect probably null
Transcript: ENSMUST00000200460
AA Change: Y492*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 unclassified probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
R7869:Setd2 UTSW 9 110550014 nonsense probably null
R7903:Setd2 UTSW 9 110617837 missense
R7952:Setd2 UTSW 9 110550014 nonsense probably null
R7986:Setd2 UTSW 9 110617837 missense
RF009:Setd2 UTSW 9 110550711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTTCTCAGTATGTAGCTCAG -3'
(R):5'- AAGGCCCAATGTTTCATCACTAG -3'

Sequencing Primer
(F):5'- CTCAGTATGTAGCTCAGAATGAAAG -3'
(R):5'- AATGTTTCATCACTAGAACCACG -3'
Posted On2014-10-02